CR00592

CRIMIC CR00592

Gene bi

CG3578

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78960

Images

Construct Sequences

sgRNA sequence
GGGTACACAGATGTCACCTGCGG

Amplicon 5' Amplicon 3'
GGGTTTACGAGGACTTGGGGCCGTGGTTATGCCTTCATAAATTGTTTTATTATTATATAGACTTGATATATTGCCCAGCCACTTGGTCAGTCAGTCTGGGCCTGTCAGTTTATTGGTTTAACTAATTTGCCCCGATCCTTCGACTCTTCTGTGCCTGCGTGAGTGTGTGCGTGTGGGGGTAATTAACGTTTATGATGCAGCTGCCTTTTGGTCCTTGTTTGTCGCCGGTCAGTTAGCAAGTTCCCACTGCCGATGGTGGGTCTCACAAATTTGTCAAATATCGAAACGATGCACATCTGTAAAATGCAAAAAAAAAAAAAAAATTTGCATTCCCTTTTCCGCAAGCAATTTGCATGCAATTGTCATTGTCATTCAATAAAATTCAAATTAAATGCAATGCAAAAAGTGGCCAAATAAATAAATCAACCGAACCAAAAGACAGATGTTCTCTAGGCAAATGATGTAAGATGATGTTGAATATGCACCCCTTTTCTCAGCTTGTATCGGAAATCCATTGGCAAAATGTGTTGACAAAGATTAAGGAGGCACTCCGAAATAAAAAAAACCGACAGCAATTTTGTTGTCACAAAGCCAAACTGTCAACGGATCCCCAGCCAGAATTTCTCGAGGGTTTCCCCGTACCCGCAACTACTGCCAACAATTTTCGGTTCCCTTTGGGCCAACTGCAGGTGCTACTTTAATCCCCGCGCCTTGTTGACACAAAAAAAAAAAAGGAGAGCCAAAAACCCACGAATGCGTTTTGCAAGCCAACTTCTCTTAGGTTCTTATTCTGTTGTTGTATTTGTACATATCCTTTTTTTTGTCGCTCCAGTGGTGTCCCTCCTTCTTGTGTGCTTCCCCCCCCCCCCCTAAATCATCTCCATTGCAGCCTCTTTGCCTCGGCTTCTCTTTCTACTTTTGGTGTTCTTGAGCTGCTGTTTGATTGACTATCTGATAATGCATTGACGCTTCTAAGGCAGGTCGGCTGCCTCACCTCTCACCTGCCGTCGAGAGCGGCACAGGTGCGTTATTAGACGCCAGCAGGGTCGGGAAAGTGGTCAGGACGCAGGACGCAGGACATCGGACGCAGATCTC GCTGATGGCATCGCTAATCGATTACATGGCCACCGCAAGCAGCCAAGATTTAGATAAGTGTCATAGGGCTCAGTTTGCCGGCGTTGAAGGATCGTTTTTGTTAAAAAAAAAAAATGAGCAACGAATTCTTGAAAACTAGGTGTCTTTTCCAAACAGAAAAAAAAACACTCTGGTATATTTGTCGTTACGATTAAATTAACACATTTAAACTTTTCATTGGTAAAATTATAGATGTTTATATTTTAAAGGATTTTTTTTGTAATGATCCTCCTAATTAATGATATTTTTAACAAATTTTTAGTAAGTGCCAAAAATGTAGCTTGACCCCATTTCGTTTTCTCGACTCAACTCTTAGTTTTTCATAATAACTTCTTCCTCATTTCGATTCTTACCAGTTTTTTGCTCCCTGTTTGCTCGGAGCCCAACCCAATTACAACTCAATCGTTGAACATTTTATTTTCGGGCCGGGCTAATTGATTAGCCATTAACCCCTATGTGGGCCTGACGAGGACAACTGAGCGACACCTTAACACTCAAGAGCTCAGCAGAACAAAAAAAAAAAAAAATAAAATAAAAAAAAACAAGGAAACAAAAATAAAAGAAACGCAGGGAACGC


Search Again