CR00591

CRIMIC CR00591

Gene Oatp74D

CG7571

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 short band OK80602

Images

Construct Sequences

sgRNA sequence
TTGCATACTTATGAGGGCAGTGG

Amplicon 5' Amplicon 3'
CTGCACTCGCTGGTATGTCAACTTCTCGAATCCCGGCTTCGACGCCACGGATCCGCGCTGGATTGGCGCCTGGTGGCTGGGGCCTGTGGCCATTGGCAGCCTCATGCTGCTGGCCTCCATCGCCATGTTCTCGTTTCCCAAGCAGTTGAGAGGCAAGCAGAAGCCGCCGGGGCAGACAGCAACTCCAGCAGCTCCAGTTGAGCCGGAGGAGAAGCCCAAGCTAAAAGGTGAGAATGTCAAAGATAGCTTGGTCTTTAGTATTTGATGATAAAGATTTTAGATTATAATCATGCCTCTGTCATCAACAGATCAGCCAATCAATGCACCTTACTCCATCTGGAACTAAATCTTAAAATTTACCCATACAGATTTTCCCAAGACAGTCCGTCGCCAGCTGAGCAACGACATCCTGATGTTCCGCACCGCCTCGTGCGTGTTCCACCTGCTGCCCATCGCCGGTCTCTATACGTTCCTGCCCAAGTATCTGGAGACGCAGTTCCGGCTGGCCACCTATGATGCCAACATGATCGCCGCCTTCTGTGGCATCCTGGTCATGGGCATAGGTATTGTCATTTCCGGGCTCTTCATCCTGAAGCGAAAGCCCACTGCCAGGGGCGTGGCCGCCTGGATCGCCTTTACAGCCCTCGTCTACTCGGCGGGCATGATCATCCTGATGTTCATCGGCTGCAGCATGAACGACTTTGCCGGCTACAAGCCAAGCGATGGCAACAGGTGGGTCATCGAAGAAGTTCTTGCTTAATTACATATTAGTTATAATTATATAATATAAGTAAACTATAAAGATAGCATTTGAAAAGGTAGAGATCCAACCAACATGAACCA ACCACTGCCCTCATAAGTATGCAAACTTTTTCCGCAACAATAGTATCCTTTTAATTTTTGGATACATGTAGAATTAATATATTGCACTAAGTGGGACTGCGGGAAAGTGGGGCTATAAGCTAGCTATCAAATCCAAAATGTAATTCGTGTTAAGTCGACTTTTTACACTTGATATACGGAGTAACTCTAGTAACATGTAACTTATTTTAATCCATCGCTAGTCCCGCCTTGATCGAGCCCACGTGCAGTGCCGCTCTCAACTGTACCTGTGATAAGGAGAACTTCGCGCCCATCTGCGCCGACGGCAAAATGTACATCTCGGCCTGCCACGCCGGATGCAGCAGCTCCTCACTGCGGCCCAGCGACAATCGCACACTCTACTCCGATTGTGCTTGCATTCCAGATGGTGAGATGCACCCATTGCCATAGCCCTAAGATTCAGTATCTTAATCCCTTTGCACCTTTCAGCTCCGGAGGCGGTCAACGGTTACTGTGATAATAACTGCAAGAACTTCATCTACTTTATACTGATCTTTGCCATTTGCGTATTTATGCATTCCACCTCCGAGGTGGGCAGCATGCTGCTCGTCATGCGCTGCACACACCCCAAAGGTAATAACCAGGATTGGCAAACAGATGTTACACTAACGATAACAAAACCCTTAATTCCCCGCAGATAAGGCCATGGCCATGGGTGTGATACAGTCGGC


Search Again