CR00590

CRIMIC CR00590

Gene CG13510

CG13510

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no band80601

Images

Construct Sequences

sgRNA sequence
GCAAGCAAACTGACTGATTACGG

Amplicon 5' Amplicon 3'
ACAAACCTATCAGCCCGGTGGCCCCACCCAGCCACCACTGTACCCACCGATGCCGCAGCCACCGCAGTCCTCAACGGTGATCATCCAGACCACCACAACCTCCAACCTGGTGCCCATCGGCAGTGGACCCACCCGCATCCGCTGTCCCTCCTGTCACGCCGAAGTACTGACCACCGTGAAGTCCACTCCTTCCGGCAGGACGCACTGCTGGGCCCTCATCCTGTGCCTGTTCATGTGAGTCTTATAGTCACTAGTCATCTGATCTGAAGTCACTGCTTGCCACCATATGTATGTATGTATGTTGATTGGTCTCAGGAGCTTTGGGCCAACGAAAGTATCTTAGGGGGGACTTAGTGCTTCATTAATCCAGTCAAATGACCTTTTTATAAAATTGCGCAAAATGGAGTAAACCATTTTTAAAAGCAATACAAATCGGATATGTTGCCTATTAAATTCAGTAATATACATAGATGATATGATATCCTATAGATGATATCCTAACAATCTAGATATGTTTTCGTATCGCCCAAGCAGAAATGTTCTATAACCATTTTATTGCCAACTCGTTACAATAGCTCGGTTAAATGTTAAAAAGCTACGCCCATGAACCACTTGCGGCCCCTTATCGCTTGGAAAAAACAATAGGTTTCTACAGGTATTGCGACTGTGTGTACTGGTAATATGTGAAAACATTGTTATCTCAACTGGAACTGGAGTTGAGTCAGATAACGAATCCGAGTGGAAAGACGGGGTGAA CGGCCTGTAGACGTCGTAAAGGCCAATTCGGAATTAGTGCTCTGACTAATAGTTTAATTCCCCGAACTTATCTAATCGATTCGTTTTCCACTCTATCCACACAGCTGCTGGCCGTGCGTATGCCTACCTTACTGCATGGACTCCTGCCAGAATGCCAACCACTACTGCCCCAACTGCAGCGCCTACATCGGCACCTACGAGAACTAACTAACTAACGCCTATTTATGCATACAAACGTATATACCTATAGAGAACCCTAAGCACTAGCGTCATAACCGAGAAAAATTGAACTGTAAATACACATGTACGAACGCCACACATTAAACTCATGAGACTCACACAGGAAACAGAAATGCGACAAGATATCTTGGGACAAGGCACTCTTTCCGCTAAATGGATTATGAAGTAATTTAATATTTTCAGAAATGTCTATGATAATGTTGACATTATTTAGTATTTTCCACTACATTTTGTACTGGTACTAAACAATTTCGATCGATCATTACGAGAAACCAACGCCAACATTTTAATGACCATTTTAAAACAATCTTTTTACTTTTTACTATCGCTTAAAAACCGTAATCAGTAAAATGGATCATAAATATCATAAATAGCTAAGACTATATCAATTGTTGTCTAGGAAACATAAACCCTTCTGGCACCTACTCAAGCCAACAACTGGAAATGGCCAAATGGCACAGAGCTACTGGAACCGAATGTCAATCGATTAGGTACTGCACTGGCCGACTCCTCTTGTACCCCTCCATATCGTCATAGTCATAGTAGGTTTCACCTAAAAAGTACTTGTCGATTAGTCAGAAAAGATAACGATTGCGATAGAGCAATGTTGTCATTAAATGGCGGGCTATTTCAGTGCATGCCCCGCCGCAAACATGAGCAGCACATGGATGGGCAGAGCTCCAGAACCGGCCGACACGGAAATGGTGACCGTAACCACGCAGCCAAACTATGGGGTGGTGGTGACCCAGATACCCGTCTACACCCTGAACGGAGTGGGGCCGGGCGCACATCCACTGGCTGTGGGCTGCAAGCCGATGAGGGTGAGGTGTCCGTCCTGCAGGGGCGAGGTCACCACCAGTCTGGCCACGTCCCCCACCCGCAAGACCCACATGTGCGCTCTGACCTTGTATATCTGCTGGTGAGTGGGGCGTCAGGATACCACCGGGCTTACT


Search Again