CR00587

CRIMIC CR00587

Gene Hr38

CG1864

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK83181

Images

Construct Sequences

sgRNA sequence
TCTAGATATCCTAGCCCTAGGGG

Amplicon 5' Amplicon 3'
GTGGTAGTTGTAGCCCCCACTGTTGTTGTGGCTGTTGCCCGCGTTGTTGCTGCTGTTGTTGCTGCTGTTGGGATGCGACATCTGGGCCTGAGACTGCAGGGTGTGCAGCTGCTGGAGCTGGGAGGGGGCGGGCGGACTGGCACTCCAGCCGCCGGACAGAGGCGGGAAGCAGTCCTCGTCCATCTTGAGGGTCAGCACCTGGTCAGTGGGCGTGGGGGCGGCGGTGGAGGAGGAGGACGCCTGCTGGGGGCTGCTACCGCTGCTGCTGTTGTACTTCAAGGAGTAGGTCTCCTGGAAGCTGGGCAAGCTGCTGCCACAGGACAGGGGCCCTCCAATGGGCGAGATCAGCTGGAGTTGAAGATGTTGCTGCTGCTGCTGGTGCTGCTGCTGCTGTTGCTGTTGTTGCTGCTGCTGTTGCTGTTGCTGCTGTGCGTGCAATGCAATAGCCGGATCGCTGCTGGAACGCAGGCTGAGCAGGCAGAGCTGCTGCTCCTGCTCGGAACTGAGCTGCTGCTCGGGGATCGAGGACAGTCGCTTGTCCCGCAGGCACGTCAACTTGGTGAGGTTCTCAATGGAGCTGGTCAGATCCTCGGCGGGATTGTCCGGATAGCCGCTGGTGGTGGGCGAGAGCAGGGAGTTGTTGGAGTCCGAGGGGAAGAAGAGATCCGAGAAGAGTTCGCTGTGCGACACGACAGACGAGTCTGTCAGGTTGCTGATCAACTGATCCTCCTCATGGGAGAGCAGAGTCTCCGACTTAAGCAGGTGTTGCTGGGGGCTCACAAGCTGTTGCTGGTGTTGCTGTTGCAGATGTTCCTGCTGCTGCTGCTGCTGCTGTTGTTGTTGCTGTTGCTGCTGCTGCTGCTGCTGCTGGTTGTGATGCTGCTGATGGAGGAGGTGGTTATGGTGTTGGTGGTGTCCAGCTGCCGATGCCGACGTCGTGGTGGTCGTCGAGGCGGTTTGCGTGGAGAAGTTATCGAAGGGCGACAATGAACTAAAGGAGCTCTGCAATGAAAGACAGTCGCGACACGAATGAGTTAGTGAGCTTGCGGTTCCC CTAGCTTTTCCGACGTCCGACATGCGCATTTCCCGCAGCAACTGCCATTGGCTCCGTGGCCGGCAAAGCAACCCCTGTTGCGAAAACTCCTCGTTGATGATTTCCTAATTGGTTATGCTTATGCCGAGGTGTTTTCCCAACATAACGCACCTAACAATAGATGGCTAATTGCTGTTTATACCGATCTGACTGATCTCCTCACCTCGCCAAATGACTTTCCTCCAGAGGAGTCACCTCCTCGCAGCTGGCAATTAGCACGGCCATTCATTTATGGGCCCGCCAAATTTGCATAGATTTCTCTGTTTAATTTTTCACAAATGATATCTCAGTGGGGGCTTGGTTTGTCAATTGCAAAAAAAAAAAAAACAAAAACAAAAACTTTGGGCATCATACTATTCAACATGATACTAGTGCCTTATCCCTTCCAAGGACTAATTTATCAAGATACTTTCTACTTACATTGGGTTGCAGAAGTAACATGCTTGTTGTGGCTTGGTTAGTAAGCCTCACTTGGCTGATTTTGGCTGCTGCTGCTGCTGATGCTGCTCCTCCCGCTTCTGCTGCTGCTGCTGTTGCTGCTGCTGTTGCGGCAAGTGTCGTTGCTGATGTTGCGGATGTGGCCGAGGTGCTGGCAGCTGCTGCTGCTCGGCTGTCGCAGTTGCTGTTGCTGTCGCTGTTGCTGTCAGTTTTCCCGACTTTCAATTTGCCCGCGCCGAGTGGTTTTATTTTTCTCGGCTCAGTGGCTGGCGGTGCTGGTGTTAGTGCCGCTGCACCTGCAAGGATAATTCGGAGGAAAGGTCTTAGCCATTTAGAATACGCAGAGTCAAGTGGGCATGAATGCCACACGGAGTCCCGGGGGTGAGCTTAATGCTAAATGGCTGGTGAAATGCCAAATCTGCGCTGATATGGGCAGATTCATATTGCTGCCGTGCTAATGTTGCCGCTGCTCGTTGCCCAATTGTCTCGCGTTCCACACGCAAGCAGCGTATCGAATGTCTTAATTAGAAATGCTCGGTCTTGCAGTCGGTCTTTCGTCTGTGAGTCTCCGTCT


Search Again