CR00585

CRIMIC CR00585

Gene Opa1

CG8479

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK80600

Images

Construct Sequences

sgRNA sequence
CTTTAAATGGTCATATACCTTGG

Amplicon 5' Amplicon 3'
GTGTAGCCCGTATCGTAGCCGGATAGCTCATCAAGGACCTCAGAGTACATGTCGATCAGGGATTTTTTGATTTTTTTTGCCGTGGTCTTTTTGTTTGTTTTCAGGATGAGGTATTGCTGGCGTAGTTCACGGTTCTCCTTCTCCATCTTCTCCAGCTCCTTTTGGTACTTAATCTGGACGTTCATGATCTCCGTCTGCAGCGTCTCCACCTGGCTCTGGAGTTTCTCTGCGGAATCACAGAAGGATTAGATATAGTATATCTTTCGGCAGGTGTGCAAAAAACCTACCATACTTCTTACGACTCTCATCGGATGTTATGCCTAAAGCGGCCACCGTTGTTTTGGCCTTTAAGTCATCTTTGGCTGCAACAGATGTTAGGAATAAGTCTCGAATGCGGTAGATAGGGATCTCTCACTTTAAATGGTCCCAACGTTGGGAGTCTGTGTAATTTGTGTAACCTACTTTCGACAATCTGAACTCCTTGATAATCGGCCGCCTCGATGGCATCGTCCAGACGACTGTCAAACCAGTTGCGCCATTCCGACAACTTATCCTCGCCCAGCTGCTTGAGCTTTGGATCTACAAGCAAACGCCCCAATAACATCAGTATCAATCAATCAAAACGAAGAGTTCAATGCGAATCTGACCA TGACCATTTAAAGTGAGAGATTGAAAGGGCGATGGTAGGTCTACATGGACACTCACCAACTTCGATGGCGTTCTTCACCAGCGAGCCCACCTCAATGAGATTCCGCGAGAACTGGCTCCACCGTTCGCCCTGCGGCATGGCATCCTCCAGCCACTTAAAATTCGGCAGTCCATCCTTCCATTCCTCGTATTTCTGCGGAAAACAAATCATGTCTCCTAAGTTCTATACAAGTTATATAACTTGCGAAACTCACTTTGCTCAGCGACACGCCCCCGCCGATGGCGCCGCCCAGGACGATGTATCGCAGCTTGAGGGCTCCCCGCAGTATGCGCACCACCAGCATTCCGTAACCACGCGACGGCGGAGGCATTTGCCAGCCCCGCGCCGGATTGCCGGCAAGTAGGAACTCCTCGTGGCCACGGTGCCTGCCATTCGAACTGGAGCTCCCGCTATCCTGCGCCCGACGTGGATGGCTGGTGATGCCACAGAGCGTGGAATGATTGCAGCAGGCGACCTTGGTGGAGTAGACAACAGCTTTTCTCGCGGTGCGCCTGTGGGCAAAACACATTGAATGATGAGATTCGCCGATGACGAAATCGTGCAGAAAATCTGCACGTAAGGCTTTCGCGTTTCGGGCGTGGTCTCTCACCGGTAAGTATTTTGATAGATGCGCAACATAATTGCTGGTCAGGATTACAGTTTCCACTTAGTTTACTTTGTTTATTTCCGTGAATAATTCAATTTTCCTGCCGCAAACTCATCTCTGAAAAACTTTACGGGATGTGCTCTGTGTGACCAGAGTTGAAAAGGGTGGCTTGTACTCGTTTGGGGTACCTGCAT


Search Again