CR00584

CRIMIC CR00584

Gene CG8668

CG8668

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78959

Images

Construct Sequences

sgRNA sequence
ACGAAACCTGGTCAAATAAGCGG

Amplicon 5' Amplicon 3'
AGAGTGGGTGCGCTTAAGACTTAGACGCTAATTAAGCTAATAATGTTTATTCCACAGGCAACATCAACAGTAGCACCAACAACAACAGCTCTGCCGACACGTTGGCTGTTAAACAATCGATTCCCGCCCAGTCACCACAACAACAACTGCCCCAGTCACAGTCGCAGGTGCAGCCAGGCCTTTCCGATGCCGACCTCCTCATACCCACTTCCAATTTGCAAAAGTTTATTGAGAACGCCGATAGGATACTGAAGAACATCACTTCGAACAGTAGCACGGGTAATTATTATACTATTACTTAGGGGGCGCTAGACCTTTGAGACCTATTAATCCAGGTTTCAAATTGTTAAACCAGATCGATAAACAGTTTAGTTGCTCCTTCAAATTGATCCTCTTTCTGTTTCATCTTGCGTAATAATTTGCCTTAGTTTTGTTTTGCTTAGACAAAGACCCGCTGGCGGCGCACCCATTTGTATAACTCCACGACAATGGAGAATGAA TGCAGTCCGCTTATTTGACCAGGTTTCGTGTTTCATTATGAAAGAGCTGTAAACATGACATATTGTTTCATACTATTGGATTACTGTCGAACAGATGTCTATGGGGACGGACTAGAATTCGCTTGAGTGTTTGTTTGCATTTCAATTAATGGTGTGGTTTATCTTTCTAAATAAAGGCAATCCATCGGATATGGCACAACTCAACGCAGTGGACGGTAAACTGGAAGTCTCGGGCGTTGAGTCCGAAAAGCAGGAACCGGAATCCAAGGTGATACAGGAAATTAAGGAGGCCAAGAAAGAGGCGGCAGTCCCTCTGCCAAAATCCGCAAAACCACCAGTGCCACCTGTGAAAACGACGAAGAGCAAGGTGCCAAGTGCTCCTGTAGATCCCTCCAAGGGAGTGGCCACCGAGACACTCTACGAGCCAGGCCACGTGGATGAGGAGATCGATGCGGAGCGCATATGTCCGAAAGGCGGAGAGTTTATTAAGCTCCTGGTTCTTATTAGCTCAGCGATGTCTCACGATGCAGCCCGCATGTCCATCCGGCAGACTTGGATGCATTACGGGACGAGAAGGGACGTGGGCATGGCATTTGTCCTAGGACGTGGCACCAATGAAACCATAAACAAAGCGCTTACCCAGGAGAACTT


Search Again