CR00583

CRIMIC CR00583

Gene CG1812

CG1812

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK80599

Images

Construct Sequences

sgRNA sequence
CAGAGATCGTGCCACATCTGTGG

Amplicon 5' Amplicon 3'
CGCTCCGCAATCGATAGCTAAATGCGCATCACTAGCGGTGCTAGCCGACTTGGCAGTTCAAACGTCAAGAGAAGAAACGTCAAAAACGCGAAAAGTAAAAAGTCGCAAGAGGGAAAAGAAGCAAAGAGGTAGCAACAAGCAAAGAAATCGCACGCGAAACTTTTTTCTCTGCCAGTGTTTAGCAATAATTTAGCTAATTTCGTGCGTATATTTGTCGTAGAACGGTTCATAGTTCGCCAAATAACGGTTTGTAGACAGCTGGCCGCGAGTGTAAACAGAACGTGCTGCCCTCTCGCTCGCACTCGCACTCGCGCACCAGAAGCTCGGTCATCTCAAGAATTTCTTATCAGACGGATTCCCCAACCTTGGGACCACATAGGTTAACATATATATAGGTTAATAGCCCGCTCTAATCTTTGGTCCGTTCCGAGAGAGTACAGCGAACAGCATGGCAGCGACGCCAGCGCCAGCAGTGACGCCGGCAGCGACAGCAACGTCGGCTGCGGCCAAAATTCCTGTGAATCCCGTGTCCCCCGAGGAGGAGACCCTTCTGCGGGGCCTCAACAAGCTGCGCAACGAGGAGAAACTCACGGACGTCACTCTGATCGTCGAGGAGCACCGATTCAAGGTAGGACCCCACCCACACCATTATAGATCCGAGCAATAGCTACATGGAACAGCCCCATCTGTGGATCTGCTTCAGAGATCGTGCCA GTGGGATCAGCTGAGCTACGAGCGGTTACGTCTAGCCTCATGGACACGGCACATCGGCGAAGGCGGATGAAGTTGGGTTGCACAAGTTTGGCTCCCAGAGTGCGCATAGCAAGTATGCATAGATTATCTTTCAGAGCAACTTGGTTGTGATTAGGCTAGGTTAGTTACGACAATACCTTCAATGGCCTGCGCATAGGACAAATAGAAATCGCACTAAACCGGATTGCTCGCATCCTAAACTCGGCGGTTTGGCAGTTTGGCTAGTTGGCCAGTTGGCCATTTGGCCATTTTGCGAGCTCGTGTTAATTATATATCGGAAACCACGAAAGCATAAGGTGACTAGTTATAGGGTTAGAGTGGCAAGTGGTAGGCGAATCGATAATCGTGGCCAGCAAAAAAGCTCATCTTTACTTTCTCTTGCTAATAATACAAATACGAAAACAAATTCGCGACACAAATTGATGTGTTTCGGCCGATGACGCATTTTCATCGCGCTACCTATGAATATTTAGGGATTCCCGGAATCAGACTCATATATTCAGATACATACATAAATCCAGAAAATTCATAGAAATGTTTTATGATACAGATTTTCAGAAATCTGATTTCAAATGTTTTCAAAAATAACATGGGGAATATCAGCGTTTTTCGTTACACTTATTACACTTATAGTAACATTTTTCCCCAAGTAATCGAACGAAATACGTAATCCCAACTTTGCAGGCTCACCGCGTCGTCCTGGCAGCCAGCAGTGACTACTTTTGCGCCATGTTCGCCGACTGTGCCATGATTGAGTCGCGTAAGGACGAGATAAATCTCTACGGTATTAAAGCCAGGGCCATGGGCTCGATCATTGACTACATATACACATCGATGCTGGAACTGAACTACGATAACATCGAGGAGATCCTGGCGGCAGCCACGCACGTCCAGGTGCGCGAGGTGATTGACCGATGCACGATCTTTCTGGGCGCAAAGATCGAGATGGAAAACTGCCTGGCCATTGCGGGAATGGCCGATATCTATGGAATTATGGACTTATCCGAACGGGCCTACC


Search Again