CR00582

CRIMIC CR00582

Gene AnxB10

CG9579

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78958

Images

Construct Sequences

sgRNA sequence
TAGCGAGTGACGCATCGCCGTGG

Amplicon 5' Amplicon 3'
CGTACTCCGGTCACGATCAGCGTGAGCAGGCGGCGGAAAAAGCCGGAGGTCTCGCTGCACATCTGCTCGGCCAGCGGGCGCTGGTAGCGCTCCTCGTAGACGGCCACGATCTGGGCCATCTCCTCGTTGGTCTTGGTGCACAGGATCTCGACGAGCGTGGCCTCCTCGGTTCCGATGCCCGCCATGGCGGCGTGCAGTTGCTTGCACAGGTACTCCACTGGTGGCATCATTAGACCCACGATCACGTCCTCGAACTTGCCTCCCAGCTCGTCCTTAAGATCGTCCACCAGGTCGCGCTCGAACTCCGCTTCGTAAACCGCCTTGATCGTCTGCCTCTGCTGGTTGCTCCTGCCGACGAGCACGTCGATGATTTCCTGCTCGTCGGTGCCGAATCCCTTCATCGCCGCCCGCAGCACCTGGGCGTCCTGGGAGGCGTCGAAGGGAGCTGCGTCCTTAACCGTGGGCACGGGCTGCACAGTAAAAATTTAGTTGTATATTAAATATAATTTTAGCAAAAAAAAAAAAGCCTAATAGTTTAGCAGCCTAACAAATATTATGGTCATATTCAAATCATTCATTTACACATATAACATTTCAAATATCAGAAAGTAGCTGCATACAATGAGGATTGAACTTCCTATGGTAACTCTCTGTTTTCGATAGAAACTAATATTTTGGAAAGTTAATACATTCAAACTCAAATCATTAAGCCATATGCATTTTTCTTCCCGTGTAGCGA GTGGCGAATCAATAACAGGCATTAGTGCAATAATGGAATCATCTCTAGCCTGGCAATCCAATCCACTCACTTTGTATTCCATTATGCAGCTGGAAGATTCCTTGGGTTCCTTGTGGCTCTTCAGTAGACGACTTCACACGAATCAGTCTTTCTCCTGGGACTTTTTTGCGAATTCTTCTTGCGACGTCTTGTCGCCTCTGCCTGCTTTTGCTAAATAATTCGGATTGGGAGGCACTGCACCGAGGTCTCTTTTCAGTGCTCTCCGGTTTGCGCTCGGTGCAGAGCACAAGTTTTACACACGAAGAAAAATGAGACTTGTTTTTGGATGGCAGAATCTGAAGGCAGCACTCGGCTACGTAAATTAAATACACATATTGTATTGCTTTTGGCTCAAAATCGATCGGTTTTTATCTAATTTCTTTTGTTTTAACATAGAAGGAATATTTTTGAATTCTTTTCGAATTTGAAATCGAAAGTTTTTTTTTAATTTTAAAGCATTTGTTATCTGTTTTAGATAATGGATGCGATGTATTGCAACATAGGTACCTGCCATTTCCCCGTTTGAAGCCAATCTTGTTTCTCTCAGTGTATAAGCTTACGCGAGCGCGAGAGAGAGCTTTTAATTCCGCTTCAATTGGGGTTGCACTTGAATTCCAAATCAACTGATTCATTCGGCACATTTCTTGAATTAATTAATTAAAACCTGGCGATGAGATCGTAAAAGCTTAAAATGTGCACAAGCATCTAGGTTTTAATGGAATTTTTAATGCGCTTTATGCCGAAAGAGTCGAAAATGGATTCAAGTGTCTTGGAAAAAGTCGCTTCAAATGTTTTCAGATCTTAAAAAACAAAATATCGAATAAAATCATTTCTGAGGGTATACACTTTATATCCGAGCCAAATAATAGACATCTTTTTCTCGTAGGATATCTTGTATAGATATTATGTTTATTTAATCTTGTTAAATAGGCTTCGCTATAATACATTTACATTTGGGCTCTACTAAAACAAACAATGGATTACCAATCAAATATGCGGGTAGTTCTATTCTTATGTATATATATATGTACATATGTATGTATGTTTGTCTATATTCTGTCAAGTAGAGAATGTTGCAGTTTCCCCTGATTTCTTGGCGAC


Search Again