CR00581

CRIMIC CR00581

Gene CG11406

CG11406

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78957

Images

Construct Sequences

sgRNA sequence
GCTACACTAGCAAAAAAGAGTGG

Amplicon 5' Amplicon 3'
CGCTCGCGATTTATTTGCCATATTTCACGGCAAAACAAAATTTAAATGTACCGTGTGCGCGGGAAACAAAAAGTGTTCAAGGCACCGTGGCGTATACGTAATGTGTGTTATACTCTAGTTAGCCGCCAGCTGGAGCGGCGTTTTCGGTGGGGCAGAGGGGGGAAAGTTTGGAGCACCTTTCGGTTGCACATTATGGTGGGCATTTCGGATTCTCCAGAGTCTATGCGGAAATACTCTAAATATTAAAATTTAACATACGGTTAGGAAATAAGCGATCTATTTTTATAGGCACTTATTTGGTTAATCACATAAAGAACCTACTGGTGTGCAGTTGCTAAACTAATTTAAAGGTATTTTGATATATTTCGTGTATTCAAATAATCTGGATACACAAACTTGACTCGTACGCACGCACCAATTAACCCGCTCAGTTGGGCATTTATCACCCCTTCGTAATCCCCTTTTATCCGCATCCACAATAGTTGTGGACCGGCTGGCCACCAGGAAGCTCTGCCCGGCAGGAGCAGCTCGTTTACGCATTTAAATTCAAATAACTTTTATTACCGAAACTAAGGCCTCCGCCCTTCCTCATTCGGCCCTCGATAGTACGTATGTTTGTCTGTTTCCGGGAGTTTCAGGGAAGTGGCCTTGAGGGGTGGGGGGATGGTAGGTGAGAGGCGGGAGGTGGTCCCACTCCAGAGTGCAATAAAAACTTTTGCATACAAGAGGAAAAAAGTTTCGGGCGCTTTGTTGGCTAAATTATGGCCCGCATATATAATCGTACTCACACGATCCAATGGATAGTCGCTGAAGCCCACATAGACGGAGGTGAAGAGGGTGCAGAGGGCGTAGGTGGGCCGGGAGGCGGTGCAGAAGAACTGGCCGCCCACCTGGGTCAGCGCCGACGCCGGGAGAAGTTCGTGGAGGCCAAGTTTGTTCAGCAGCAGCTGCACGGAGAAAATGCCACCAGTTTTAGTTTCAGTTGAACTTTGAGCTATGTTATTTGCAATTAAAATCAGAATCATGCTTATCCTTTAAATCTAAATGTAATATGTCCTATTTTCCTACAGCTTTCAACTGTCA CTAGTGTAGCTTAGAACTAAGACAAATGCTAATCTTCTCTAGCAAACTGCGTACTTCCCGAGTGACAAGAGCTTATCACGCGCGCAGCACGCGTCAAGTATACGCACCGTGGCCATGGAGCTGTCGCTGGCCAGCAGCCGCAGTGGCGGACTGCTCAGGTGCTGGAGGAATGCCACCGGAGCCAACAGGGCGGCATTGGCGAACCGCGCATTGTACTCCGGCCGCTGCGAGAGCAGCACCAGGAGAACGGTGGTGCCCTGCGAGTGCCCGACGTAGTGCAGCTGGCGGCGATTCGTCCTCGCCAGCACGTAATCCACGATGGCGGGCAGGTCGTAGATGCCAATCTCGTGCCAGCTGAATCGCCAGAAGCGGGCGTCACTTGTCTGGAGCGTGCGGTGCCCGCGGGAATGGGTGGTGCCCCTGGCGTTCGCCAGCCAGACGTCAAAGCAGCGGGCATGAAGCTCCAGCGCCAGGGATCTGCCCCTTCCGCCCGACACGAAGTCCCCGGCGGATCCGAGGAGGCCGTGCATCAGGAGGAAGGGGCGCAGCTGTTGGGGGCACCAACGGTTTTGGGGAGCGGGAATGCGGTGCAGGCTCAGCCGGTAGCCATCGGCGGTCTCTATGCGGTGCACTTGGCACTGGAGCTGTTGGCGCTGCACCGCCTGGCACACTGAGTCTGACTAAACCAGGACAGTGGACCACTATCACCACCACCACCACTATCTCTGCGTAGAAC


Search Again