CR00579

CRIMIC CR00579

Gene Cyp6v1

CG1829

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78956

Images

Construct Sequences

sgRNA sequence
CCAGGTCCACGACACACGTTCGG

Amplicon 5' Amplicon 3'
ACTCCACGAACATCCTGCTGGCGATAGTGACGATCCTGACGGGCGTGTTCATCTGGTCCCGGCGCACCTACGTCTACTGGCAGCGCCGGCGGGTGAAGTTCGTCCAGCCGACCCACCTGCTGGGCAACCTGAGCCGGGTGCTCCGACTGGAGGAGTCCTTTGCTCTCCAGTTGCGCCGCTTCTACTTCGACGAGCGGTTTCGCAACGAGCCCGTCGTGGGTATCTATCTGTTCCACCAGCCAGCCCTGCTTATCCGCGATCTCCAGCTGGTCCGCACCGTTCTGGTTGAGGATTTCGTCAGCTTCTCCAACCGATTCGCCAAGTGCGACGGGCGCAGCGATAAAATGGGCGCCTTATCGCTATTTTTGGCCAAACAACCCGAATGGCGCGAGATCCGCACCCGTTTAGCACCAGCCTTCGCTGGCGCCAAGCTGAAACAGATGTTCTCGCTGATGGAGGAGGTGAGTCACTCAACCAGCCGGGTCCAAGTTGCAAACTCCCGCTCCCAGGTCCACGACACAC ACTCTTACACCGACCAACACAACACACATTTCCACGCTTAATCGCGGGGCCCGATTGAAGAAAAAAATAACCAACAATACTATTTTACTCTGGTTTGACTTGTAATTACACCGATTCCATTTAAAGATAGGAACTGCCTGTTATTCAAATCGAATTCCATTCCCTTACAATCGAAGTGTTTCGCCGGCATATCGTTTTGGATCATAGCTATATTTTAATATTTCGAGGTGCGGCACTTACACCAAGCTACTGGGTAAAATTATTAAATTCAATTTTTTAGGTTCCATTAAATTTCCTCTTCTGATTGTAATGTTTCCAATTTTGATCAATGAGTTACGAAATGGCATATCTTATATTATTGATTATTAATGATAAAAGAACCTCTCTAACGGGCCATGTTGCTATCTGGGGCTTATCAAATCGAACCTGTTTATTGTTACTGACTTGTTGTATCTTATCAAAGGTCACCACCAACTACGGCATTACTACGAAAAAAAAACCATAACGTTTATAGCTCAAGACTTTAGCTCTCCTCTGCTTAGTTTGTTGCCTAGTCGAACCAAAAGTTCTATGCAAATTAATGCTAAGAAATCACAAACTGTGTGCGTTTCAGTAAAACAAATCGAATTTACTAATCATTGTGATAATGCAAATTCCCATGACAAAGCTGAAACTCATGTCCAAACGGTTGACAAGTCTCTAAGGTTTTTCTGTTGTATATCTGTTATGCAAATATCAAGAATCACATCGAGGCACTAATGAAACAAACACTTAATGAAACACTGATTAGCTCTAGCAGCAACATTTGGATACCTATTTATTGATTAACAATCCGTTTGCTCTGTGCTCCTTGTGGGATGTTCTATATCTCCGTAGATCGGCTGCGACTTGGAGTGGTATCTGAAGCGTCTGACTCGAGATCTTAGACGCGGCGACGCGGAGCGAGGGGCGATTGTGAGCATCAAGGACGTGTGTGATCTGTACAACACCGACATGATAGCCAGCATCGCATTCGGACTGAGATCGTACAGCCTGAGGAACACGCAATCGGAGATCGGCTCACA


Search Again