CR00578

CRIMIC CR00578

Gene santa-maria

CG12789

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK80598

Images

Construct Sequences

sgRNA sequence
ACTAATCGAATGCAGCTGGCCGG

Amplicon 5' Amplicon 3'
TAGTTCGGCACATATCGGGCGTAAATAGACCAACACTATCGCCGGGCTTCAGATGCTGTGGCTGGAACTCCCCGGCGGATCCATTGGTCATACCGCAATAGGAATCAAAGAATCCAGTGTTCTCCTGGTAATTCCACGAGTGCATCTGACCCAGTTTGGCCAGTTGATCGGCGCCAGTGAAGACATTAAAAACTCCGGTAAGATCGGCACTTCCATTGCGCGTATAGAACCAACCGAACTTATCGAATGGAACCTTCACCTCATCACCAAAAATGGGCATGGCCATGGCCACGTCGATCATTGCGTCATTGTAACCGGTGAAGAGCAGCTCATCGATCGATTTTTGGACAGACATCTCGGCACCGTACATCTTTAGTCCCACATCGACAAGGGAGCGCTTAACTGGTGGCCAATATTTGGCTGTGGCGGCTGCAGACTGAAATGGAAATGTATAGTTATAGTTATATTATGTAATAAAAGGGAATAGGATACTTACCAGAGCCACTGCATTAAGCGTGGTAATCTCATCGTCCAGGCTGCCATTACTGCCCGCCGCATCAAAGTAGAACAAGCTGCGCCTGCGATAAGTGACGGATGCATTTTCTGGATGCCAGTGAATGTCCACCTTATCGGGTCGCTCGATAAAACGATAAGGACCCACCTGCTCCAGAATGGGCTTTGTGGAAAGGTTGCCGAAATCCTCCGGATTCGTCCAGTTGTACAGGTAGATGTCCAGACTGAGATCAATTGGCGGACTCTTCCAATTTTCATAGACACGTGTGTCGGGGGCCAGAGCCATTTCCTGTCGAAGAACAGAAGCCGCAATTGGTATTAATTGAAAATCTCAACGAGTTTTCCTCGATCTTTGACTCGCGCCAATTGAGAGGCGGCTGTTTTTCTTTTGACTTTCAATTGGCTTTAGCCACTAATCGAATGCAGCT CCGGGCTAACACTGGAGTGAAGTGAAATGAACTTAACTGAACCTCTGTCAATGACTGGGATTACCTTGTGCATGATCCAATCGAACAGGTCCACCCAGAACATGCCGCACAATATGCCAAATAGTCCCAGGCAAAAGCCGAAAATGCCGATAATTAATTTGCGATTACTTTTTTGGCCCCACATTGCGCTGTTTTGTGTTGGCATGGCTCACGCTGGGCGATGGTGTGTGGATACCTAATGGTGGCTGTAATGATATGCAAGTCATTGAAACATCAATGAAAATGGATAAATTGATAGTCTATTTGCCAACATATAAAAATGGATCAAATGAAAGAACTCATAAATGTAGTGCAAGTTGAGAATGTACTGATAAGTTTTCTATTATAAAATCATTATGAACAAATCATAATACAATAATTTAAAATATAACTTTACACAATATTATTTTGTGAACTCATGTTCATGTTGCCTACTTTCAGGCAGTGCTAGTTAAAGAATAAAAAAAATGTAGAATCAAATCTCTTATTAACAGATGCATCAAGTCACATATTAATATAAGTATGGCGAACAAAGAAATCAACAAAGAATTGAATACAAATAAAATGCAAAAAGCGCAGCATTTTATTGAGTGACGAATTCCCATAGCGTCTATTTTTATCAATATAATTGAATCAATTTAAGCAAAGCGTGACTTTCAATTGCTGTTTACACTCATGTAGAATATACTAAGTCCGGTAAGTATATGTGTACATATATACAGAACTATAGTCGAATCCCCTATCAGTGGTGATAATTACAAAGCTTCCCCCGACAC


Search Again