CR00574

CRIMIC CR00574

Gene CG42255

CG42255

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80597

Images

Construct Sequences

sgRNA sequence
GTATGGGGACGTCGAGATCTTGG

Amplicon 5' Amplicon 3'
ATCCGGTAATAGGCGGCATGTTCCACCATTTAGGCAGGGACTTGGGTGGCACGCATCCGATGAGTTGCACACAACGCCGGAATAGCCAGGCTGGCATATGCACGTGGTTCCCCTTCCGTTCTGGACGCAAGTACCGTTGTTCTGGCAAGGATGCTGGTCGCAGGGCAGTCGACTGGAGTCCGCGCTGCATCCATCGGCACCATAGCCATGTCCAAAGCTGCCCAATGGGCAGGTGCACACCACCATGTCGGATACATACTCGCACTTGGCCAGCGGATGGCAAATCCCCTCATTGTTGCACGAGTTTGAATCCGATGCTGTGCATGTTCGTCCGTCGCCCGTCCAACCGGCTGGACATCGGCCACAGCGATGTGAGCCCTCTGTGTTGGTGCAGGTTACCCGTGGCTGGAGGCTACAGCCGCCATTATCCTCGGAGGCACATTCGTCTATATCGCGGCAGAAGCGCCCATCACCCGTGTATCCCGTTGGACAGGCTCCGCATCGAAAACTTCCCGGCAGATTAATGCACTCATCGTGGCAAGGATTCACGCGCGGCTCACACTCATCCACGTCGCGGACGCAGGCACTTGGGCTGGCTGAGGTCACATTGGCATCTGCCCAGGTCCATCCCTGATCGCAGATGCACACATAGCCAGCGGAATTGGCCGCCTGGATGCAGGTGCCATGCTCGCCGCACAGCTCCCGGGAGCCGCCGAACAGACAAGTGTTGTGACGAAGGCGACAGTGGGTGCCAGTGAATCCATTGCGGCAAACGCACCTAAAACAGCAATTTTGCGGTACATATTTCATTTCCTGCACGTGGAACTTCTCGTCAACTTACCGGTAACTTCCTGGAGTGTTAATGCACTGACCATTGTTTAGACACCCATCGAGATCTGTTCCGGCCAAAGTGAAGCACTCGTTTACGTCGTCCTCACAAGAGTCACCCTAAAAATAAACGAATTTACTAATCCCAATAAACTTCTGTGCTGGAACTATGTACATATGTATGTACATGGAGTGATAATTCTAACCTCAAACCTCTATAACTTCTTTAACCATGAAACGCCCCAATAACTGTATTCAAAAGTCAAATACAGTCGGATTTTTGGCTCTCTTATT ACCAAGATCTCGACGTCCCCATACGGACAAACGGACAAACATGATCAAGAATTCTTCATACGGTGACTTTTGGTAACTAACTTGCATTGTAATTAAGCCAACGCATTTCCAGTCATATATGTAAGTTACTCTTTCGTGTGAAAATACGCCCCATAATCTCTTGAGAGACGCCCCCGCTTACTCACTTGCCAGCCCGCCGGGCACTCGCACTGGAATCCCTTGTAGGCATCGTGGCAAGTTCCACCGTTTTTGCACGGATTCGATAAGCACTCGTTTCTGGCCAGGTTTCCCGCGAGGGTCTGCAGTATTCCTTTGACGCGTTCCACGCGCTGCAATTGCCGGCGCAGGATGCGTTGATTGAGCCCACTTCTTTTCGTGGAGTTTCTCGCACTGAAGATCCTTCGCTGAATCCTCGTCATTTTAAGCTCCACATCGTGGAACATATCCCTAACGGCGTCCACTTTCAGGGGCTCCCTTCGCGCCGCCTGACGATCCGCAATAATCCTTTGACGCCGCCGAAGCACCGTCATCATGTCTACATCATTGATAGTCACGGTGGCGG


Search Again