CR00572

CRIMIC CR00572

Gene Oaz

CG42702

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80596

Images

Construct Sequences

sgRNA sequence
CCGGCTTTGATCCTAGCGCCTGG

Amplicon 5' Amplicon 3'
TTTGCCCCTTTGGTGACAGTCTTCTAAATACTTAGGACACCTTTAGGCACTCAGGGTGTCAGGACTTTGATTGACAATCTGCGGTGGTTCCATTGATTTTCATTTCCATCGAGTGAATAGGAACCAAACTGCGATTTCAATTTGTTAATTGAAAGCGAAAGTGGCATAGCTCTTAGATGTAAAGGGTTGTTTAAGTGGAAATGTCAAATCTAGCATGTACGCAAGGCTCGTTTCTCCTTTGAACAATATATGTAAAATAAAGGTACGTTCTCTGAAATCTTCCAAATGAAACAAATTAGGATCAAGTGAATTATTTAAAAATTGCAGACCTATATCATTTATCTAACACTCCTTCGGCAATCTCTAAAACAACATCTAAGACAACCCGAAGCTTTGAGCCTTTGTGGCCACCGCACTTCACCCACATGCCCCCTCATCTCCGCGAGCGAAAATTCTAATTCGGCTTAAATGCTTTTTGAACTGCTAACACCGCCGCCCATGACATCAGCAACTTGTTAACCCAATTGCAACTGCTGTTGAGGACTACCGAGCAGCGATCTTTATCGTCCACCGGGGTCTAACATGTTGCGATCCGGCTTTGATC TGGTACGGTTCGGAATTCGGTCTTTCAGCTTATGGGATGTTGATGGCGATGGTGATTGGAGCGACAGTTTAAAAAACCATAACCAACACGAGAAGTTGTACGCTCTCTGTGGATCTGGATGCGACTAACCCGGCTAACTCATCATATATTGTGCAATTTTAAGGCTTTCCAAACTGGGGGGCTGCATACAAATGGGCTAATTTTTTTTTTCGCCGCTCTCAAAGTTCAAAGCCGGCTGCCGCTAAAAGAACCCAAAAAGCAAACCGGTTGCGGGTGTAGTTTAAGACCCAACCCCAGCCCCAGCACCTGCCCCTTTTCCAGCCCAACCTGCGAAAGAAAAAAAAAACAAAAAAAACAGTAAGCGGCGTCGCGCATTTAGATGAATTTTGTCCACAAGCCACGAGTCGCAAGTGAAACACCTACTCGTCTGGGCCTGAGTCCGAGTCGAGTCAGTCGGTATGCAGATTCAGATTCAGATTGACGCATCTATAAATTCAAGCCAGGAGTCGTCCAAGTCGTCGTCGTAGTCGTCATCGTTGTCATCGCAACTTTTAACTGGGGTAGACGGACAGTTGACGCTGCCTTGTTGTCTGGTGCTCTTCTAAGAATTTCAAATAGCCCAGTGGGCCTACGGCTAATTGCTCAGATTATCATCATGCTAATGGGATTTTCCGAATATGTGTATATTCATTACAGAGCCACGCTGAACACCTGCCTTTCAAATGTGAATACTGCTCCAAGCTCTTCAAGCACAAGCGATCCCGAGATCGTCATAAGAAACTGCATACCAACGAGCGGAACTACAAGTGTCCGCATTGCGAGGCAGCTTTTTCCAGGAGGTAAGTGAGGGAGTCTGGTTTAATATGTGACCTATTAACTAAGTCAATAAATTTCCTCTATTTCATCTTTCTCTAGTGACCACTTGAAGATCCACATGAAAACCCATGACATACAGAAGCCCTTCCAGTGCAGCATGTGCAACAGGGGCTATAATACAGCTGCTGCTCTAACCTCGCACATGCAAAAGCACAAGAAGAATGCAGCCATCCTGGCAGCCGGTGGCAATCCGAATGCCCTCAACTATAGTCCGCGG


Search Again