CR00571

CRIMIC CR00571

Gene CG10353

CG10353

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78955

Images

Construct Sequences

sgRNA sequence
CGTCCGCCACGGTGATAGGGTGG

Amplicon 5' Amplicon 3'
GGCGCAGGTATATACGCCATCCTGGACGAGCTTCTCGATGCCCAGATTGTCGGCCGTCTCCTCGCCCTCCACGAAACGCTGGCGCTGGAGAATGAAATTGATGATGGAGTAGCGGGTGCTGGCGTCGAGAAAGTTCGGGTGCTCCGTATCGTACAGTTCCAGGTAGTTGCGGGAGAACTCCAGATGGATGCGCGGTTCGCGTTCCGGAAACAGGGCCGTATTCAATTGGACGGAGCTGAAGAGACTTTTGCACATGCGACTGAAGCAGGTCTTGAACTCGTGCGCCGATTCGGCGAAGATTTGATCCTGGCCGGGAATCGGTTTGAGCGGCACCTTAATCTTGAGTATTTCCGCATAGCGATACAGCACCTCCGCCGGCGCATGGATCTTGATGAAATGGACGCGCTGCACCTTGTTGTGCTCCAGCTGCAAGCCCTCTCGCTGCAGATTCGCCTCAAAGATCTCGCATTTGCGCCGATGCTCCTCCAGCTGCGTCTCTCCGTTGTAAGCCAGCACAAAGTCCACGCTCCGTTTGCCATCGTCGAAGCGTCTGTATGTCTGCAGAGATTCCGAGAGATCCGGTAAGAAGCACGTGATGAACAGCGGAAAGAGAGCAACCGTAGATGGAGAGCATTAGTAAAAATCAGTGTGAGTCACTCGAGAGCGATCTTAAAAATATACATTTGCTTATCAACTAGACGGAAACAAAGCGTGTGGGTGCGTGTTTGCCTAATGGCCATTTCCCCCTGGTCACCAC TGGTCACCACCCTATCACCGTGGCGGACGCCTCCCGCCGATCTCCCGAGCGCAATCCGCGCAGGAGGCAGCAGTTCAGCATGATGACAGCCCGGGGAACCAAACCAAATCGAATCGAACCGAAACACAACCGACGTGGTCGAGACACTACACGCAAATATTGGATTCTGGCCGCTCGGCTGGCTCTACTGCAGATGGCCCAGCTGTTTGCTGCAATCAGTAGCTGATCCAAAGTAACAAAACGCCCGACTTAGATACTAAAGATATCAGTATACAAAATTCGCATTAAGTGTTCATACCCAATCCCGCAAGCAAACTATAGGAAATAGAGAAATATAAACAAACAAAGGAGAGCGTGAAAGAAGGCGGCAAGAACTTGATCAAGTGCAGAATATGTAAATGTGTGTGTGTGTGTGCATCATTACAGCAGCGGGGCAATTGTATGTGTGACTGGTGTGGGTACAGTGGTCGCTCCTTAACGCGAAATCCTCTTCGATTCCCTACTATGAATATGAAAGTTACAGAGCCTCTAATTCAGTCAGTGACTCATAGAATCTGATAATGATCTTAATTCAAAGAGTCTATTTTTAGAAGATCTTCTATAGATTTTTACAAAATATAGCTAAGTACTTGTTAGATTGGCATTTAAAAACATTGTTAATATATTAAGTAATGGGAATTGTTTCGAATTTCGATGAGTAATCAAGGGAGTGCGTAGGAGCAACCACTGCACCAGTGACCATCGAAACTCGTGTGTGAAAGCTGGAATGAGCGATCCGGCAGATGGTTGAAAGTGACTGGCGATTGGCGGATGAGATGACTGACTGACTCGGCATCCACGCAACTGCAAGACAAACATGGTGGTGAGATCGATGGACGTGCGAGGGATAAGGACATCGGCG


Search Again