CR00570

CRIMIC CR00570

Gene Gal

CG9092

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78954

Images

Construct Sequences

sgRNA sequence
TGACAGGTTAAGTGCAGTGATGG

Amplicon 5' Amplicon 3'
GAGGTAGTCGTGATCGCAGGCATAGTCACCGTACTCGTTCTCCACCTGCACCATTATGATCTTGCCGCCGTTGCCTACGAACAGGTGCTGGAGGCGTGGCATCAGCTCCGCATACCACTTGCCCACCTCTGAGATGTAGTTGGGGTCATTGGTCCGCATCTTGATGGACGGGTATTTGGTAAACAACCAGTGAGGAAGACCACCCTGAAAAGAGGCAATATTAGTCAAAATTATGAATAATAATACTAATTTCGAACGAAAACCAGTTAGAGCCAAAAACGTTTGTAGTAGAGAAAGTATTTAAGCACATTCAGCAACAAAATCATTTTATACTTGCATTATCTCGCTCAGCACAAATGTAGGGACCTGGGCGGAGAATGATGTAGAAGTCTTCCTCCTGAGCAATCTCCAGAAACTTGACAACATCCGCAATGCCCTCCCAGTTGTATTCTCCATCGTGCGGATTGTGGAGCGACCATTCAACATAGCTGGATAAAGTAATCTCGAGTTATTAATATGTTTTCCATACATTAATTTAGAAATAATATAGCTTACGTATCCAGAGCATTAAGACCAGATGCTCGCATGGTGCGCAACCGACTTCGCCAGGACTCGGGTACAGCGCGGAAATAGTGAAACGATCCAGAGACGTACCGGAAGGGCTGGCCATCCAGCATGAAGGTGTTGGCCTCATGGTCGATCGTAAACCTTGGCTGTTCCTGTAAAAAATGCGCATTTAAATCAGGCACGGATTTAGCAATCGCCTTATAGTTGCACGCAAGGAAAAACCATTTGGTTGGGCAACTGCAACTCACCTCGAGGAGATCGGTGTTACCA TACCACCCATCACTGCACTTAACCTGTCACTTGAATAATTATAGAGATTGCCAATCTTAGTCAGACTAAAAAATGTTTAACCCAGTCTGCTAACTTGTATTTATAAAACAGTTACTACTTTTATTGTTGTTTAATATTGAACGATGTGAATATAAATCGAAACTCAATGCCTACATTGCTGTAATGCTCAAAAAAAGATATATGAGTTGCTTTTACTTTAAATATCATTATAAGCCCAAAAGCCTTGTAAATACAGCTAAGGTACTTTTTGTATATCTAACAAATATTAATTTTTATGGCAGCTATGCTATAAAGTAATCCTGTAAATGTAAGTTGACCTGACCCAATTGCCCAGGTTGTATGTTCGTGTAAATTATTATTCTCACCTCGGGGGCGTCGGTGTCACCGCTCAGTCCCACACAAAGCCCAACGGTGAGGGCCATCACAGCAATTATCAGACATCCACTTACGGCCATCGTCAGCTTTCGATTGCGACGACAACCGCTCATATTGAAGAGCCGACTTGGGAGCTTGGAGAAACACCACAAATGTATCGCTAGCGATATAAGCTTGCTTGAAAGCTCGCTCCACTCGGATGGGTGGACCAGAATACACAACCGATCGCCAGTGCCGACGGGAGCACAATGTCAGGGTAATGGCTGGTGGGCAGTGGACAGTGAGTTT


Search Again