CR00565

CRIMIC CR00565

Gene ND-MWFE

CG34439

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80595

Images

Construct Sequences

sgRNA sequence
GATTGGTGCACAAACAGCTGCGG

Amplicon 5' Amplicon 3'
ACTCGACAATACCGCTGGTGGCCATCCTGCTCTCCGCTGATTTGTCGCTCTGCTCTTTGTTGGTAGTCTTCTTGCTGCTATTGCTGCGCTCAGAACTCTCTGCGAATTCCTTCGTAGCTGTTCAATGAAGAATCGGATTGGTAAGACCGAGATCTGAGTGCAAAAAAATGGTCCAGCTGGATGTACGAAAAGTGCATTGGGAAAAATACCAACCCGAATAGAGCGTAAAACGGTCACGCAGCTTTACACTGGAATTTGTTTTCTATATACTTTCGAGCTTTGAAATTGATTATAAACATTGCGTACATTTATCAGCTCTACTAGATATATCAGATCTATTTACAAATTATTTAAGCCAACTATTGGTCAAAAACTATTTTCAAATCAACATTGACGTTTTTCTAAACGCAGTAGCAGAATAGAATTCAGTCACCGTTACTTTCTTATCGTTACTGGCCCACCTCTAGTTCAACATTCAAGTTTTTGGTATATTTTGTAAGGCTACCTGTATATTGGAACGGACTATCCACGGTCACACTGGGTGTCGTCTTGCAGTAAATATCATAACAATCTATTTCCATTGACAATATGTGGTTCGAAATCCTACCTGGTGCGGTGATCATCACCACGCTCCTCTCGGTGCCCATATACGCCATGTACGGCCTGGACAAGCTGATGATCGGCAATGTGAGTCCCACGCTGGCCTTCTGGCCCAGCAGCCCGAAATTCT AGCTGTTTGTGCACCAATCGGAATCTGTTAAACATTATTTAACCGCCTGCTTTTCGCAACGAGTTCGACGGAACACTACGGAGTTACTAATTGTTTGCTAATCGTTTGCTCAACAGGCTTTCCGGCGCAACATGGACGAGCGTTTCAGCCGAGTTATGTACCAGCGCGATTTCCGACTGACCGACAATCCCTACAAGATGAACGTAAGTGTTGTGCTATAGTCTGGCCTGCCTACAACTGATTTTTGTGCGGCAGGCCAACCATCACGTTTTTACCCTATTTTTGGCAGCAGTTTTGTTATCTCACAGCACGCACTTCATTATTATGCACGCTCATTTTGGTTTCGTTGTTTATGTTTTTCTCTGAAGTATGTTAAATAGATTGTTTTTGGTGTTATGAACTAGCTTTCTTCACTAATAAAATATTAGTTTTAAAGTTTTCTATATTATAAGGTAATTGCATTTAAAATCTTAGTTTTCTTGGTTAATTTCGTTTTTATTGTTTATTGATCATTGGTGGCGGTAGTTAATGTTACTTTATTTCCTACGAATTCATACCATCCATTTTTTTACGCTTATTCGAAGAGTTATAAGCTTAAATCATTTACAAAAAACCGAACCAATCTTCTTGCAGGGTCTGGATGCCATACCGGATGAGAAAACGAACTAATTTTAATTAAGTAAAGTTTTCCGTTTAAGCTTAAGTGCAAAAGTGAATAAACGAAACGTGCAGTTCGGAAGTGATAGTTGAAATGGTCGTTTTTGGTTTTTCCTGTAGTTCCTTACAGATTTTTTTTTGCTGCCTCAGGTGTAAAGCTTCTTTCTCTATAGGGTCTTGAACAAATTCCCGATGAAGAGGTGAAGAAGGAGGAGAAGGACCCCAATGAGGACAGCGATGATCCCGCAATCGTGAAGAAGCGGGAGAAAGAGCGGAAGCTAAGGGAGAAACAGCTGAAGAAGGAGGAAAAGCTCAGGGAGAAACAGCTGAAGGAGGAGGAGAAGCAGAAGAAAAATTAATATCAATAAAAACAAACATTTCGCCAGTGGAGCTCTCAAGCCGAGCACAGGACTTTCGGCCGCCTTTGCCGCGCATTTAGCAACCCTGTGCTCGTGACAGGAAA


Search Again