CR00564

CRIMIC CR00564

Gene Kal1

CG6173

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK80594

Images

Construct Sequences

sgRNA sequence
TGCCGATTGGCCGGACCACCGGG

Amplicon 5' Amplicon 3'
TGTGCCCTGTAACGCCTTAGCAATCCGCACGTTATGATAATTTCAGACACACCAGTTCGAAATCAAGGAACTGCTACCCAACTCCTCGTACTACATCCAAGTGCAGGCCATATCCTACCTGGGTTCGCGTCGCCTCAAGTCCGAGCAGTGGTCGATGCTGTTCAACACGACGCTGCAACCTCTGGAGCCAATTACACCGCTTCAGTGCTCCGGGAATGGCAATAGGCGACGGCATCATCACACTAGCAGCTCTATGAGCTCGGAACGGGCCACAACCTCGGAGCCAGTTGCCCTCAATGAAGTTTCGCCCACCATTACAAACCGGACATCGGCCGCCGCCACGTATGAAGTGGGTTTCCGGTTAAACCGGAAGTTCGGCATGATTGTGCAGATTCTGGGCTTCCAGCCACACAAGGAGAAGTAATTATTTGTAAACAAAATGCCCAAATGCATAAATTTCATGCCATCACCCCGATTGCAGGGTCTATGAACTGTGTCCCCAGGAGACGAACTGCGAGCAGCGAGAGTTCCGCGCGATTCGCGCCAAAGTAAGTAATACCCTTGATGATGCTCTGATGGGAGCCACGAGCCACATGTCGGAATACTTCG CGGGCAAGGGCAAATTAGTGGAACATCGTTGACCATGGGGTATTGTTTAACAAGGCGCAATCGTGTTTCCTCTATTTGACACGGAAAACACGTCTTTCCAATTGGCAGTACGTGGTCAAATGCCAATCAAAATTTTCCCAATATTGATGAATAGAATCGGGTCATGCCATAGGTGTTTGCCAAAATACAAAGATCAAACAAGCGAATGCTGCCGTATGTTAGATACATTAAATTCATTTTGATTGCAGAAAGACCCGCTGGAGTTCAGCAAACTGAAGTACAACACCACGTATGTGCTGAGGATTCCCCGTTCCAGTCCCAATTCCGTGTTGGACGACTCCAGAAATGTCTTTACCTTCACCACGCCTAAATGTGAAAATTTCCGCAAGAGATTTCCCAAGCTGCAGATCAAGTGCAGCGACTAGCCTTCTCTGTATGGGCTCAACGCACTGCTGACCATGAGATTACATTAGATTGTAAATAATTGTATGTAAAACTTAACTTTTACTTATCGTTAGGCCTAAGAACAAACAACAAGAAACTAAACACCGATCGTTTTTTACGTGAAAAGGTCCTTAAACTGCTGTAGATCCTGCTGATGAACGGGTTTCTGACTAATAGAGCCCAAAAGTTTGCAGTCTTCCAAGCGCACGCCATGCTCAACAAGAGCTGCTATCAGTCGCGAGGTGTAGAGCACTGGTCCGCCCACCATGTGCAAGAAATCATAGTGCTTCTCCCGCCGCGTGCTAAAAAGGATTCGCTTAGAGACAAAGTCTCCGTAGTTGCTGATACGTCCCACACAC


Search Again