CR00562

CRIMIC CR00562

Gene Vha68-1

CG12403

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK79277

Images

Construct Sequences

sgRNA sequence
GCATAATGAGGAAGATTATGCGG

Amplicon 5' Amplicon 3'
TGTAGATGGAGGCCTCACGAGCAGCCACCGGCATGTTGGAGGTGTTGGCCACCAGAGCAGTTCGCTTCATAATGGACTCGGTGACGCCATCTATCTCGCAGGTCAGTTCGGGAAAGTCACGCAGTACCTCAGACATCTCGTTACCGCGCTCGCCGCAACCGACGTAGATGATCACATCAGAGTTGGAGTACTTGGACAGGGCCTACGGGTGGTTGAAGTGCAGATTGGAAGGGATGGTCATTTAATGAGATGTAAGATGTGGATTAAGTGAATAATTTGCAACTTGCCTGCGAAATGACGGTCTTGCCGCAGCCAAAGGCACCGGGGATGGCAGTGGTGCCGCCCTGTACGCAGGGGAAGAGCGAGTCAAGGACGCGTTGGCCCGTGAAGAGCGGATGGTTGGCTGGCAGCTTCTCTGTGACGGGACGTGGCTGCCGCACTGGCCAGACCTGCAACATGGTGTGCTTGGTTATCTCGCCGTCGAACTCCGTCTCCAGGACAATGTCCTCCAGGTTGTAGTTGCCCGCGGGGGCAATGTATCGAACGGTTCCCTTAGCCCTGGGTGCCACAATCATGCGCTGCTTCACCAGCGTGTTCTCGTGTACCACTCCATACAGATCTCCTCCGGTGATGTGGGATCCCACCCGCACATTCAGCGGATTAAATTCCCACATCTCCGAGCGCGACAAAGCAGTTGTGTTGACACCTTTGGGTATATAGATGGAGTTGGTCATGACACCAATGTCCCGCAAAGGACGTTGGATGCCGTCGAAGATGCTGCCCATAATGCCGGGTCCAAGTTCCACGGAAAGAGGTTTGCCGGTACGCAGCACCGGATCGCCGACAGTCACGCCAGAGGTCTCCTCGTACACCTGGATGGTGGCCATGTCGCCCTCCAGACGGATGATCTCGCCCACCAGCTCGTAGTAGCCGACGCGGACCAACTCGTACATAGCTGATCCAGACATGGCCTCAGCGGTGACCACTGAAGTGGATTTAAAGTTGTTGAAGGAGGAAAAGCAGGAGAAATATGATTAGCAAGGAGTGGAGAGAGCAGCATAATGAGGA ACAGGAGGAGGGGGAAGAAAGCATACAGAAATATGAAAAGGAGAAGGATAATAAGGAAGGATAAAAAGGAAGATGTGGAGGAGTATAATTAAGAACAGAAGAAAGGCAGGATTAAGGATTACAGAACTTGGGGGTCAGCGCATGAAGGACGCTGGTGACGTCGCTTACCTGGTCCGGATACCGCGTAGACACGGCCATATTCCGACTCGCGCTCCTCGTCTTTGAATTTCCTCAAGTTGGACATGGTCGCGGTTGCTGCTCTTCTTCTTCTGCTTCGGTAACGGTCAAATCGTTCGTTGGCTGTGGGAAAAAGTAACCGTTTTTCTTATAAACAAAAACACGCATTTTCCATGCCCCCGAATGAGAGAGCGTTTTCCGCGAGGAAACGCATAGGTGGCGCTGATGTGCAGCAGCAGCCCCCAGTGAAAAGCTTCACACCCCCGCAGCACAGCATCGATTTTCCAATACAATTTTCACACATGCCACCAACGGCAAGGTGAATTTTCCACCTTTTACCCATCACAAAAGCAATTTTCACACTTTCTTTTCATTCAACACCTTGTGGTCAGTGGTTTTGTGGCGTAAAAACTGCTTTTTCAGCTGCTCTAAAATTAAATAAGCTCACATTTGTTTCAACAGCTCTTATGAAAATTCTCTTGCTTTTTTGATTTCACTCTAGTATTGATCTATCGGTTATCGTCGAGGGCTCCAG


Search Again