CR00561

CRIMIC CR00561

Gene UK114

CG15261

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK short band78952

Images

Construct Sequences

sgRNA sequence
ACGATGCCGATTGCCTTATCAGG

Amplicon 5' Amplicon 3'
AAAACACGAGTCCGGGAGTCGGAGTCCGTAAAAGGCGAAAAGAGCCTGAAAGGCAGCCGCATCAATATGGAGCATACACTGTAAACAATTAGGGGTGGCAACAGAAGTGGTAGATACACGTTTAACTGCATTGCAAATCAAAACTTTATTTGATGGCCAATACTTACGCTGCTTATTTATGCTGGTTTTCTAATCAATTTAAGGTAAGCACTAATATATTTCTGCAGTGTATGGGCAATGTCCTACAACAGCAACAACAGCTCAAAGTCGGCATTATGAATAACTTTTAAATTTGAATGTGAAATAATCGCTTTGTCTGCGCGGGCTACCGTTAGCAACATGCTGCTGTTGCAAGTGTTGCTGGAGCTGCAGTGGCTGCTGTTGCTGCCAGTGATTTATGCAGCAACATTTGATGAAATATAATACAAAAGGCGCACAGCAGCCGCAGCAACAACAAAGATAAATTGCCGCACGCTAAATTGTAAGCTATATAAGGTTTAAATGCAAAGTGTGTTGTCCGTAGCCTGTTGCACGTTGCATGTTGCATGCTGTTGCTCGCCGCTTGGCTGCTGCATGTTGCAACAAATGTTGCTCGGCATTTATGGCTTCATTTGACAACAGTATTGAAATCACTACGTTTTCCAGCACTTTTCCTACGCTTTTTTTTTTATTCATTTGGTTCTACTTTTCTACTTTTCTCACAATTTATTAGACATTAGTTGCTATTGCACGGTTTTCGTCTCCACAGATCCGGTCAAGGCAATGCACTCGATCTCCACCAGAGCATCCATGGGCAGCTTGGCCACCTGGAAACAGCTGCGGGCCGGGAAATCCTTATTGAACACTGAAACGGCAGATAAGGAGACATAAAGCATATAGTTGTTTTTGGAAATATAGCATAGCTGCCATAAAGTGTTTACAGTTAACAATAAATGGGCGATAAGGCGCTAACGATGC CGATTGCGATCAAAAGGCCGGTGTATACAGTAGGTATTGCATTATAAACGACCCTTATAAATAGTGCTTAGTATTCACAAGCCATATGCCTAGTACTTACCCCGCTTGTAGACCTCATTGACTGCCCCGAAATCGTTGAGATCCTTCAAGAACACTGTGTTCTTGATGACTTTGTCCACTCCGGAATCGGCCGCCTTTAGAACAGCCTCCAGATTCTCCAATGCCTTCTGCGCTTGTTCAGTGGGTCCTCCAGGAACCAGTTTCATGGTGTCCTTGTCCAGACCCAGACATCCGGACACATACACAGTACGATCGGCCACCACAGCCTGGCTACATAATTGTAAATCACAATGAAATAGAAGGTGTGTCCAGCAGCTTTTACAGGTACAATTGTTTTCTTACTTGTAGGGAGCCACTGGCTTGGCAGCATTTGCAGTGCTGATAAGTTTCCTCACAATCGTCGACATTTTGATCTCGAAATACGATACTATATAAGTGGCAAGAACAAGCAAAGTCAATTGCAGCTGCTAAAAGTGAACTGATCGAAAGCTTTGACTTGCGTTCAACAAGTGACTTTTGTTATCAGCTTTTGCTTTTCACAAGCTCATTCGCTTTTTCCCGCGCAAACAGGTGCCATCAGCTGATTTGATGAACAGCTGTTCAATGGATCTGTTATCATAATGTTAATATAATGTCAAATATAATGCTCATTCTGTTGCAAATGTAAAATATTGGGTAATATAATGGAAAAAATTATATTAATGGGTGAATTGCGAATGCAAAAAACGCTTATTCCACATAGCTTAGATATTTGTTTCATTTTTGCTTTGCGTGAAACCTGGCAGTA


Search Again