CR00559

CRIMIC CR00559

Gene Sod2

CG8905

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
ATTACATAAATAGCAACAAATGG

Amplicon 5' Amplicon 3'
GAGGGACGCACGTTCTTGTACTGCAGATAGTAGGCGTGCTCCCAGACATCGATGCCGAAGAGCGGGATCAGGCCGGTGGAGGCCTCCAGGGGATCCTGGTTGGGCAGGGCGGCCAGTTGCAGTTTGCCCGACTTCTTGTTGAAGCCCAGCCAGCCCCAGCCGGAGCCCTGGACCGCCACGGTCAGCGTGGTCAGCTCCTTTTTGAACTCCTCGAGGCTCTTCCACTGCGACTCGATGGCCTTCTTCAGATCATCGCTGGGCTGGGTCTTGTTGGGCGAGAGGTTCTGCCAGAAGATGGTGTGGTTGATGTGGCCACCGCCATTGAAACGCAGGGCAGGAGCCAGCTGAATCAGCTTGGTGGTGTCGCTCTTCGACTTGGCCTCCTCCAGCTGCTCCTCGGCGGCATTTAGATTGTTGACGTAGGTCTGGTGGTGCTTCTGGTGATGCAGCTCCATGATCTCCCGGCAGATGATAGGCTCCAGGGCGGCATAGTCGTAGGGCAGCTTCGGTAGGGTGTGCTTGCCACGCACCGCCAGGCTGCAAAGGGTTAAGTGTGTCTTGTTTTATAATGTCCTCAAGATCAGGGTCG GGGTCGCCATTTGTTGCTATTTATGTAATCAGCCGGCATCGATTTGGGCATACTTTTTTTCGCAACTTACCTTGCAGTTTGCGAAATTTTACGGGCCACGAACATATCTGCGTTTTATTCGACTGCTAATAAGGCTAAGTCCCGATATCAGATTTTATATCAAATAAAACAAGGCTTACGTTCTCGTTATTTCGCTTGTTCTATTTGAACAATTTACTGCTAGAGATGAGCAGATGAGAAAATATCGAAAGACCCCAATCAGTCAGTGATGTGAGATCAACTTATATATATTGAAGTTAAATAGTAAAACTAAAAGAAATTAAAAACTATTTTTAATTGAAACATTGCACTGAAACATATTCAAATCATATTGAGGATTTCTTAAATATTTCTTATGTTTAAATACTACTTTAGTGACTATTAGCATATTTTAGCTGCTTACGTATCGACTGCATCCATTCGATTGATACTTGAATTAATCGATTTTTGGCCTCTGTATGTCATGGCGCTAAATTGGAAATAAACCATGAAATTAACGTCATAAGTTTAAAAATCCGACTGGAACACAGCACACAACATGTCTACATTTCAAATACCTTCCCGAATCAAAATCGATATAACAAATAAACGGGCACAGAACATTCTTCACAAATATCTACATTTACGTAAGTTGCTTAAATAAGCTAAAGATTTTATGATTTGACCATGATTCGTTCAGCAACCTCTCCTGGAAACATGAGCAGCGAGGTAGATAGTAATTCACACCACGCCGCAGTGGTTATTGACAACGGCTCTGGAGTATGTAAGGCTGGATTCTCCCCAGAAGATACTCCCCGTGCTGTCTTCCCGTCGATTGTGGGCAGACCTCGTCACCTGAACGTCCTGCTGGATTCCGTGATCGGTGATAGTGTTATTGGCGAGGCGGCAGCCCGAAAAAGGGGAATACTAACCCTAAAGTATCCCATCGAGCACGGAATGGTCAAGAACTGGGATGAAATGGAGATGGTTTGGCAGCACACGTACGAGCTCTTGCGGGCGGATCCAATGGATTTGCC


Search Again