CR00558

CRIMIC CR00558

Gene parvin

CG32528

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 short band OK80592

Images

Construct Sequences

sgRNA sequence
AGTGGCCCAAAATGACCCAATGG

Amplicon 5' Amplicon 3'
GCCTCGAGTATTCGGAGGTCTTCTCGCCGATCTTCGTTCTGTTGCAGCTCGTGGCTGTGCGCGCCTGCCAGTTGCCCAACTCCATCTAAACCATAGACGTAGTATAGCCCTAGTTCCGTATTATACATATATGTAACTATTCTGAAAGCCTTTAAATCATTGGATTGGTAGTTATCTGTATACGCAATGTGGTACAATAATTTTTAAGCGGTACGAAATTTATCTTTCTGGATATAGCATATCTAATATATACGAATTATATCTGATCTGATTCGGTATGAAGGACATACATACATACATATGTTGTTGTGCTTTTTAATCAATGATCTAATGATCTACGCATTATAATTTTTTTAAAATTTCCAACAATTTAATTTGATGTACAAATTCAAAAACTATTAAGCTGATATGAATTTCTTCTAGCTGTTGTTGTCAAAAGCCACATTTTTTTTAAATTATAAATGAAAAATAACATTTAAGCTCATTGTTTTAATTTAATCTAAGGTCTTTTTAAACAATTTTTATAATTGGCAATTTAGTTTTTATTCGATTTTTTTGGAAGTTTCTCTTGAGTCCGAACGCCAGTGTTGGACAACATGTGTGGTGGGCCTGCGATCAGGTGGCAGCCCCAAGGGAAACTGATTGCTCAGCTCCGCCCGAAACGAATCGAAACAATAACACAAACTGTTCACTTAGTCCGGAATTCTTGGAATCCAGCAGCACCATGTCCACACTGAACCGCCCTAAATCCCCGCACACGCCCACCGCCATTAAAAAGGGCGAGAAGGAGGACAGCTTCTGGGACAAGTTCAGCACTTTGGGCCGCAAACGCGGCACCCGCGAAGGTAAGTCCACTTGATGATTGGAGCTCTCCAGATGGCTATTGTCGGCCAGGAATTGATGGGTATCCCAGAGTATTCCATTCTTGGACCCCTGAACCTCCGAAAAGTGGCC ATGGATCCTCCCCCTGCGCACTGGAAGCTCTTCTGGGAACAGATGTGCGGATGCGCTGATTAATCAGAACATTGCGTCACTGTTGACCCACACAAGCAAACGGCGCTGATAATCGAGAGTGTGTGCGTTTGTGTGAGATGGCCTTGTGTCGTCACCGTTTTTGTTTACCTTGTTGATACCCTAAATACGCATCCGCTTGCTCCATTTGCAGTGAAGAAGGTCCAAGAGGAGGGCAAGTACGCCATCGACTCGCCTGGATCGCCCAGCCAGTATGACATCCCGCCGGAGGACTATGCCCTGCGTAAGTGCATTCGTTTTGAAGGGGCATCTCCTCGTATACCCATCGCATTTCCCACAACTCATCACATTTGATCCTACAGGCGAGCACGAACAGCGCGCCGTCATCGATCCACAGTCCATCAGTGATCCCCAGGTGATAAAGCTGCAGCGCATCCTCGTCGACTGGATCAACGACGAGCTGGCCGAGCAGCGCATAATTGTTCAGCACCTGGAAGAGGACATGTATGACGGCCAGGTGCTGCACAAGCTGTGGGAGAAGCTCACCGGCAAGAAGCTGGACGTTCCTGAGGTCACCCAGTCAGAGCAGGGCCAGCACGAGAAGCTCAACATCGTCCTGAAGGCCGTCAACCATGTAAGTAGTAGTAGTTTATGTTTTGCAGGATTTAAAAATCGGAGTTACCAACATTTAATTATTTATCCATTCTTAAAGTCGAATAGAATAATTTTTATTCGATTTACAATTAACATTCCCTTTTCTCGCGATATAAGAATAAATTTTATCCTTGCCCACACCCACAGACACTCGGCTTTCACCAAAAGATTCCCAAGTGGTCGGTGGCCAGCGTGCACTCGAAGAACATTGTGGCCATATTACATCTGCTGGTGGCACTGGTGCGTCACTTCCGGGCGCCCGTTCGCCTGCCAGAGAACGTGTTCGTGACCGTCGTGATT


Search Again