CR00557

CRIMIC CR00557

Gene Su(z)12

CG8013

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band short bandOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
TTGTGAACTCATGACGATGGTGG

Amplicon 5' Amplicon 3'
GGCGTTGTTACTGGTTGCTGGCAGTGAATGGTTATTGCTTTTGTTGCGGTTGGCTCCGCTTCCACTTCCGCCTCCGTGTCCATTTCCGATCCCGGTCCCGGGACTTCCGTCGCTGTAACGCTGCCGCTTGTTAAGCACTGTATTATCTAGCAAAGGTCCAAAACATATACCATTAGAATTAGAGCGGGTCAAATGCAAGTTGAATCCAAGTTACTACTGATTTAGTTGCCCACACAGTTGTTGGCAACTGGGCTCGCAACTCCATTCATAACTCCCACGGCACCAAATCCGCCACACTCATCATCAATAATACCAACATCGACAGCATTATCGCTGTGGGTCAGCACTTCTGGCGCATCCGCCGCCTGCTCCACATCTGCCACAGACCGTGCGTTCACATTGAGAGGAAGAATTCAGTTAATGTCCAAAGGAAAAGCGAAAGTTTTGAAAGAAAAAGGTCCAAACGATACAATTTTGATTGAATTTTGGGATTTGCTTCTGATCGG TGAACTCATGACGATGGTGGGATGCATTGGATGTTTTGTACATATGAAGATGCATGTAGCGATTCCTTGTCTTGGATATGTTATCAGTTTGGTCTGCATAAAGCTACTTTATGTGGCACAATTGATGATGATATGTTCAATGGGGGAAATAGGGGCTTACACAAATTGCAAACGATAAAAGATTATAAAAGATAATAAGACTTATCTCAAATATCTCAAATAATAACTTCATTTACATCGATTTTAAATGAAATGAGCAATTCGGATTGCCAAATGAGAAAGTAATTCTTTGATTTTGTATATATAAGGCTCACACTATCGAGTTGCAATTATGTTTAAGTCTCAGAGACGATTCATTTTTCATTAGGCATCAAGTTTAGTCAGATTACTGTTTGTAATCCCAAGCCATTGTAAAAACAAAAAGGCAAAGTTAAAATGACTACGATGGGGATGAGACGGGTATGCTTCCTGCCTGCTGATGCGGCACTCACCTTTGGAGCTCAGC


Search Again