CR00556

CRIMIC CR00556

Gene eIF4G2

CG10192

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78951

Images

Construct Sequences

sgRNA sequence
AATTAGTTACGACAAAGCATGGG

Amplicon 5' Amplicon 3'
TAAGAGATAGCTGCACGCGGATAATGTCCATGTGCCGCTGACTGGAGTTCGAAATTCCACCTCCTCCGCCACTTCCACTGCCCATACCACTGGAACCGCCCATTTGCTGATGTTGGTCGTGGTGCTTCTTGTTGGGTCCGTGACCACGACCACGCTTCCCGGGCACATAGTCCAATGATTCGTTAAAGCTCATATGCTGGTATTGCTGGATGTGCTGGCCATGGTGCTGCTGCGGTTGCTGCTGGCGCGATACGAACAGCTGTGAGATGCAGTCGCCCTTCTGGCAGGGCACCATAGGTGGCTTACGTGAGTCTCTTCGCTTGGCAAGCTCACGTAAAGTTTCAATGCTGTAGCGATAGTTTTTGGGAACCTGAGGAACTGGAATCGGACTGGGACTCTTCGACTTCAGCTCTTTTGTTTTGGGGGACCCCGGTCCTGAGCCAGTTGCCTTATGTACCGGAGAGCTCTTCGTGCTACTTGCGCTCTTCTCTTCAGAAATTTGTTCGACAACCTTGGGAGCACAATCCACATTATCTGCACTCCTGCTGCTTTGCGATGAGTCGTCCTCCGCCGCCTTACTGATCGTCGAACTTGACCATGTGGAGCTGCATATGAAACCTGTGTCGTTGCGTGGATCCTCATGAAAATCACCGAACTTGATTTCGGCCTCAGCATTCTCCTCCGTTTTGGTCACTCCTTCAGAGATCACCGGAACTGGCTCATCTTCCTCACAAACTGAGCTACTACTGTTAAGGAATTGAAGCTGTTGCGTCTCCGCGTGCACAACGGATGTGTCGGGGCTGTCCTTCTGCAGGAACTTGGCCACAATCTCTTCGTTGGCTAAATGCTTCTCCGACTTCTCTCCGGTAATGTTCGACATGCTGTCGTCTTTGATGTCAGCTGAAAAAAAAAATGTTTTTATTTGACTATCGTTATCGTTTTATAAGATAAATTCTTAGGAAATTCAATTCCTATGAAAAGAATTGCACAGAAAATAACAACTAGAAGAGCTGTATGTATAAAGATAGGACGCTCCC CGCTCCCATGCTTTGTCGTAACTAATTTTAAAAGACTAATTTTTGTAAATTAAATAATTTGTACTTACATTCAGGATCGCTTTCCACCTTCGCTTCGATGCCATCCTCATTATTATTATTGTTGTTGTTGTTGTGGCTTGTCAATTGCTCCTTGGGATTGAGCATAGTTTTTTTGTCTCTTAGAATAGAACTTACTTTAGTATTATTACTAGTTGCACTAAGCGTATCAGTCGTCGGTTGCGCCGTCTCCTTGTCATCGACAGCCGCCGTTTCTTGTTTGGTTGTGGGTGCTGTTGCCGTGGTTGTTGTGGTCAGTGTGCTCATTGATGTTGTGGTCACTGTGGCAGCATTGTTGCTATTTGTGTTAATTTCTAGCGCGGCGTTGCCATTACCATTGCCCTTGCCATTGTTGTTCTGCCCTTGAGTGCTTGTAGTGCTTGTTATCGAGGATTTCTGTTTTTTCTTCTCCAGCTCCCTGGCCCGTTTTTGGGCCTGCCGTTGTTTCTTGGACGAGTTGGTAGTGGTTGTTATGTTCGCGGTGCCGGCAAGCAGGGTAACAGCGGCCGAGATTCGTGAAGCAGTCGGTGGTAATGCTGGAGTTGATACTTTTCCTGGAATCTGCTTTCCATGCTGCAGATTGTTAACAGGCTGCTGTTTAAGCTTACTAGATGCGTGGGTCGGTGTTGAGGCTGTCGACGAAGAGGCACCCGAACTGGTCGTAGTCGAGGTGGCGGCTTGAATACTCGACTTCCTGTTGGGTGAACCCGTTGTTGGCTTAACCGACGCAGCTACAGCTGTGGTAACTATCGACTTGGTCGACTTCTGCTGGGCGACACGCGAAGGTGGCGGGGGTGTCGAGGGGCCAGCTGGTGTTACCATCGACTGGCCTCTGGACAGGATGGAGACGCCTGGGCAACCGCTGGCTGCTGCCTCAGCTACGTCATTCGCTATGGATGCTGGCGTAGCTGTACCTGTGAGCAAACAATTTAGTCGACGTTAATGGATTAATTGTCACGGAACATACTTTGTTTGTTGGCCAATTTGGGACGTTGCTTTTTGGCTTGCTCTTGGAAAAGCACTGGCTGCTGGCACGTATCGGTTGTATCGGGCA


Search Again