CR00554

CRIMIC CR00554

Gene Adhr

CG3484

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78950

Images

Construct Sequences

sgRNA sequence
ATTAAGTTTATGTTTCAGTTCGG

Amplicon 5' Amplicon 3'
TGGGACTCCGGCATCTAAGAAGTGATACTCCCAAAAAAAAAAAAAAACATAACATTAGTTCATAGGGTTCTGCGAACCAGAAGATATTCACGCAAGGCAATAAGGCTGATTCGATGCACACTCACATTCTTCTCCTAATACGATAATAAAACTTTCCATGAAAAATATGGAAAAATATATGAAAATTGAGAAATCCAAAAAACTGATAAACGCTCTACTTAATTAAAATAGATAAATGGGAGCGGCAGGAATGGCGGAGCATGGCCAAGTTCCTCCGCCAATCAGTCGTAAAACAGAAGTCGTGGAAAGCGGATAGAAAGAATGTTCGATTTGACGGGCAAGCATGTCTGCTATGTGGCGGATTGCGGAGGAATTGCACTGGAGACCAGCAAGGTTCTCATGACCAAGAATATAGCGGTCAGTGAGCGGGAAGCTCGGTTTCTGTCCAGATCGAACTCAAAACTAGTCCAGCCAGTCGCTGTCGAAACTAATTAAGTTAATGAGTTTTTCATGTTAGTTTCGCGCTGAGCAACAATT ATTTCGCTGAAGGACTTGCCACTTTCAATCAATACTTTAGAACAAAATCAAAACTCATTCTAATAGCTTGGTGTTCATCTTTTTTTTTAATGATAAGCATTTTGTCGTTTATACTTTTTATATTTCGATATTAAACCACCTATGAAGTCTATTTTAATCGCCAGATAAGCAATATATTGTGTAAATATTTGTATTCTTTATCAGGAAATTCAGGGAGACGGGGAAGTTACTATCTACTAAAAGCCAAACAATTTCTTACAGTTTTACTCTCTCTACTCTAGAAACTGGCCATTTTACAGAGTACGGAAAATCCCCAGGCCATCGCTCAGTTGCAGTCGATAAAGCCGAGTACCCAAATATTTTTCTGGACCTACGACGTGACCATGGCAAGGGAAGATATGAAGAAGTACTTCGATGAGGTGATGGTCCAAATGGACTACATCGATGTCCTGATCAATGGTGCTACGCTGTGCGATGAAAATAACATTGATGCCACCATCAATACAAATCTAACGGGAATGATGAACACTGTGGCCACAGTGTTACCCTATATGGACAGAAAAATGGGAGGAACTGGTGGGCTAATTGTGAACGTCACTTCGGTCATTGGATTGGACCCTTCGCCGGTTTTCTGCGCATATAGTGCATCCAAATTCGGTGTAATTGGATTTACCAGAAGTCTAGCGGTGAGTTGAATACGATCTTATGCGGATAAATTCATAATTTTTTGGTTTCAGGACCCTCTTTACTATTCCCAAAACGGGGTAGCTGTGATGGCGGTTTGT


Search Again