CR00553

CRIMIC CR00553

Gene Syt14

CG9778

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78949

Images

Construct Sequences

sgRNA sequence
AAAGGCATTCAACTTTCGGTCGG

Amplicon 5' Amplicon 3'
GTGACCCCGTTGTAGCTCAAACCCAGCAGCAACTCGGAGACGCCCCCGTGCTGCATGGACGAGGTGGAGCCCGCGCTTTCTGACCGAGCCAGGCTTAACAGATCGCTAGTAGAACCCAGGCCCGACGAGGTGTTTCGTGGCTCCAGCGGCAGCCATAGGTTTGTTTCCAGTTCAAGGTCAACAGTGGCGAAGCTCACATACGCCTCCCCAATCAGGCGTTCCTTGCGCAGCCGCTCGCAGCCGTAAAGCCGCACACGCAGCCCCATGTTGTTCACATCTTCTGGGTTGACGCGATGGAGAAGAAAGCTCTCCATATACTGTGGATTTTCGCCGCTACGGATCTTGGTTTTGAGCTTCTGCTTTTTGCTTGGCAGCATCAGCATCCGGACCTGCGTGTGGGTGGTCTGCCCACTACCCAGGGGCGGAAGATTTTTTGCCTGCATCACGTGCACCGTCATTTTCCGCATTGGGGCGTCGTACAGCAGCGACAGCTCCAGCTCGATGGGACCCCTCTGCACGGCCGGCTCCTTCTGGTCCACACCAACCAGTAGGTCATCCGACTTGATCGAGCGCAAATCGCTGGTGTCAAATAGGGGTTCCTGGAAGTTGAAAAGTTTTGTATGTTAAAAAAAGTTTCAATGAAAAGCCCTAAAGCATGGTACAAGAAAATATGAAATGCTATCGTTGAGTGCCTCGACTATCAAGAACGCATTACCCATCAAAAAGATTTTATAATAAGAGCCTAGGGATAAATAGTTTTTGGAATATCAATTGGTACTCGCAAGTAAAGTAACTTAAACACTTTAATTTATTTTTTAGCAAAGTATCGGATTTTGACAGATTAATTATATTTCTTAGAAAGAATTTTTAATTTATGCGGTGCACATAATTTTTCAAAGTTAAGATAATAAACTTTTATTTTACACATGCAACGCATTAATGAATTTATACAACGCATTAATGAATTTTAACTTGTCAAGCAAAAAAAGATTGTTAACAGACTATATGGACCATAAGAGTCGGTTAGACTCGACTATGCTTGTTGGGTAAACTTTACGAGTCCGA CGAGTCCGACCGAAAGTTGAATGCCTTTCTAGGCATAGTTTCTTTTAAAGGAATAGGTATTTAAAGTACCTCTTATGTTGTAAAACTTACGTCATCGTTGTTGTTGCTGCTGGGATGGTTATTGCTGGTTGTTATCGAGTTGTTGTTGTTGTTAATGCTGTAGGCATTGACCATGGGCACCACCAGCACGTTGTCCCGTTCCTTGTCCAGCTTTGGCGGAGCAGCCACGTTGACCCGGTGCTGGTACCTCAGTGCCTGGGTCTTGGCCCGGTGTTCTCCACACGGATTGCGGAAGGCTGTCGCCGGGTGGGGAACTGTGGTTGTGGCTGTCAAAAGGTCGTGACTCATTGCAACGGCTGTCAATTAGCTGGCCCTGACCCCGCCTTGCTTACCTTTGCTCAGACCCGTCAGGACGCCTGTGTGACTGTCCACGGAGACCTCCATGGAATCGTTCGAGCTGCACTCACTGTGCGATGACGGGATTCCAACCTTGCCACGCTCGGCGATGGCTAAGGGGTCACGCGACACCGTCACACGCTGCAGGTCGGCACTTGCGCCTGCTTGGTGGTAGTTGAAGCTCTGCGCCGTCAGCGGATTAGCCTGGCTGATTCCCAGCCCGTATCC


Search Again