CR00552

CRIMIC CR00552

Gene Vrp1

CG13503

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78948

Images

Construct Sequences

sgRNA sequence
ACGCCCAAGGTAACCACCCAAGG

Amplicon 5' Amplicon 3'
CTCCCGAGCCTGATGACAAGCCCGAGCTGCTGCCAAACTGATGCGAGGCATTGGCCATGTGCGTTGGTGGCGTCGATGGGGCGTTGGGCCGAATGGATGAGTGACGCTGCGGCGGAACTGGCGCTGATCCCGATCCGGAACCACCCTGTAAGAAACGAGAAGTCACTTAGCTTGATTCTACTGCGGTTTTTGGGGCTATCATAGCGTGTAGTTACGTTGCGCTTGCTGTTAAGCATATTGATAACCTTGACTGACTCGCCACTGTGCCTCCCTTGGCGATTTATATGGAGTATCTTCTTAAAGGAGTACACCGTCTTGTCTATCCAGTACTTCACTCGGTCCTGCTGGAGGAGCACATGAATGCGGGCCACTGGGCCACGGAATACGCTTAGGGCAATGGGTTGTGTGTAAAAGCCCAGTGTTTTGGTCACGTCTCGTTTGGAAAATCAATCCACCCCGCTCAACACAAAAATAGGTGAGTTATAAACGGAACACTAGCTTGGACTGATATGAACAGGCAGTGCGCAGCCAGGAGCGCTTACAAACAGGTGAGACTGCGCAGGCGCAGTGAGAATCTTAATTTAAACGAAGACAGATAGGGTGAAAAGGGTGGCCCGAGTTCAAGCGAGCAACAAATGCACTGCGCAAAACTAGATGATTACTTAAGGATAAGTGCCGAGCAAATATACATCGGCTCACCCATTATCTGGTTTACCTTTAAGAGCATTTCGAATGACTAAGAATAGTATTAATTTACGTGCTCAGTATGGTCAGTCCTAGTTTACTTAAAATATATGTATATCCCTGACTTCGGCCCCACATCTGCTCAATACATAGGCAAAACGCCCAAGGTAACC GGCATCGCAGTCCATTAAAGTTCACCTCTGACATTCGGGCCAACCTGTTGTTCTGCGCTGATATTATTCCTGTCCGTTTGCTACTTACATTGCTCGACTGTCGCTGTGGAGGCGGCGGAGGTGGGCAGCTGCGGTGTGGTGGCGGCGCTGGCGGATTTAGAGGACCTCCATTTAGGATAATAGGTTTGACATTGTCTCGCAGCAACGATTTGGGACTGGCGCTTGCTGAGGATGGATTGGACGAGGGTGCGGGCGTCGGCGGCAGTGGCGGTGATGGTGCTCCGTTAGACATTCCGGCGCCTCCACGGAATTGGTCGCGCAGGGCAGCCACGCTATTGCTGCTGCTCGACGATGATGGCGGCTGGGTAATTGGCGGTGAGGGAGCCTGAGAACTGATGGCCGAGCTCTGGATAAGAGCTGTGTTCACCGCACTGAACATCGTCGATCCGCCGATATTGTTCAGATTGGTGTTGGAGAAACTGCGAGCCGGCGTGGGTGGCGGTGGTGGTTTTACCGATGGGCGGGCTGTAAATGTATGTTGAACAATTAGAACAAGCGTAAGTTAAATCTCATCAATTTCAATATTATCAGTAAAATATACAATTTTGAATTCGTTAAAAGATTAAGATTGCCGTATGGGTAACAAAAAAGATAAAACCATTCATTTATAGTTTGAACTTTGAAATTACCAAGGAAAGGACTCTTACACTTTGGCGGGTTAGGGGCACATCTCATACTGCCTGCACTGGTGTTGGGGCTGCTGGATTCGCTGCCATGGAACTGCAGTGGACCGCGCAGGGTGCCTAAATGCTGCTGGGTGGGGAACACAAGGCCGTTGACGATACCGGCCGCAGGCGGAGATCTGTAAAAGAAACTTCCCCAGATTAGCTGAATTCATTTTAGGTCCTCCTCGATTGTTAAAGCCAAAAAAGCAAGAAGCGTAAGAAAAACCACAAACGGAGTTTGATGAAAGCAGATGAGCGTTAGCTGCGGTGCTGGATTACTAGGG


Search Again