CR00551

CRIMIC CR00551

Gene DIP2

CG7020

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 no band OK79276

Images

Construct Sequences

sgRNA sequence
AAACTGTGGCAGACGTAGTCTGG

Amplicon 5' Amplicon 3'
GCACAGCCTCTTGTCGTACTTCTAGGGGTCAGATGATCAGAGATAAAATGTTGTTGCTGTAACTTGTTCTACTAACCAGAATGATAACGTTTCTCATTGTGCGTTACTTTGCGCTGTGTGCGTCGTTGACGATGCTGACTATTATTAGTTGACTGTTGGTTCTGAAAAGCACTTGGTTCGCGAGTGTTCTGATACCCGGGATCGCCGACTGCTCCACCCTGCGGTCGCATATTTTCGTAGCCAGGAGCCCCAGCATTTCCGCTCTGTGGTGCCGATGACAAGCTCATGGCGGCTTGCTGATGGAAGTCAATTTTTTTGGAATGTCTTTGCTGCGAGGAGGACAGGGAGGGCACTTCAGTCACATAACTGTAGCCCTCGCTGGACACAATGACGCCGTCGTTATTGATGTTTCCGTGGTTGGTGCTGTTGTTGGCATTTTTAACGTTGTAGTATGGCGGTGGCGGCGTACTTTTCACTTTATCGCCTGTTCACAACAAAAGGATCAAGAACTTTCTGGTGACGACCAAACGACCAAATATCAATGTTTTCGAACATACCTTCTGGCTTCTTTAGGAACGGCTGCAACAGCTTCGCCCTTTTCTTTTCGTAGCCTTTCTGCGTAATGTCACCTAGAAAAGCAGATGGAATTGTTTTCTTAACGATTAATATGTCCGCTGGGCCTCGTCGTTTTTTGAAAAGCGTGGAGTAGCGACTGAATCATGTATTCATGCTGAAAGCCACACAACACAACACACACACTTTTCTTTTAATTGGTCGGTCCCCGACTATATGTGGGCAGCTTTCAGCGAAAGAAAAGCCGAGAACAGCACTTGTAATCCCATTTGGGGGCGACAAGTATCCAATGA GCCACAGTTTTCACGCGATTTTCTACAACTCAGTCGCCGCACTTTAACAACAATATTTTATTTTTGTGTGTATTATTCAAATAGGTATACCTTCCGACAGCTCTAAGTCCAGTTCGGCGAGCTTCTCGCGGACGTAGCCAGGCAGCGAGGCAGTGTGCTCCATGGCAGATGAAAAGTGTGGCTTTAGGGTTTTGTTCTATCCTCTTCCTTGGAGGATTCGTCTAAACTTTGGCTGGTCGCAGTACACAAACACACCCAGACACCGCTACTTTCCCACTTCGTTGTCAAAAATCGATCGATTTGCCATTTATTCTATTTCACATTTTGCCGACGCAAATAAATACATCCGTACTTGCGCAGCACCAGTACTTTGGGTTAGTTAGAAAACACGATATTACGAATGTCTTTTACGAATTTGCACAATGAAAGTAAACAAAGAAAAATAGCAGTACAAATCGATTTTATGAACTAGCGAAAAATTGATAACTATTTCTTCATACTCTTGGGACAACGGCC


Search Again