CR00548

CRIMIC CR00548

Gene CarT

CG9317

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78947

Images

Construct Sequences

sgRNA sequence
CATTGATTGTGCGTTGCTTAAGG

Amplicon 5' Amplicon 3'
TGATTCCGGCATGACGAACATGTACAGGAAATAGGCGTAAAACGGCAGGGATGTGATGTAGGAGAGGCGCACCCAATCCCGCTCCAGATAAGTGACGCCGGACAGGAGCATGATGCCCGAAGTGTAAAAGGTGCACGTCATCACAGTCACGAAGGATCGATAGTTTTCACCCACCAGTTCCAGAGCTGCAGACGCAGAAAAGTTAATGGTTAAAGTTAGAAGCAACAATGAAATACCCACATATTATAAATGGTATCTGGTAGACAGCTGGAATGGTCAGTCCTACGATGACTCGACTGCCGGCCCAAGTCCAAAAATCCTTGCTCAGCGAAGTCATTAGGCTGCCAGCCAGCAAAGTGGCCAAACAGACGAAATAGGAGAGCCTTCGTCCACCACGATCATTGAGTAATCCGAAAAGATAGACTCCCACTGGACCGCCAGTATTAAGAGCAGCCAATCCAATCGTAGGATAAATATCCTGATCGCACACTAGATCGAACTGAAATAGGAGGATTTAATGGTTTATAGTAAGCCAATCCTTCGCTCCTAGGTAAAGGTAGTACTGATGCTTGGGAAATGATTCGAGCAACTCCTACATGAATGACGTTGTAGTTTCAAATGAAGGCTTGGTGGTCTGGATTGCGCACATCAATCACAATGGAGGACCAGACGACGCTTGTGTTGTACTCCCATCCCTGGGGGCACTTGATCAGTGGCCAACTGGCATTCGGCTCCATGGTCGTCAGGTCATCCTCTTCCCCCGATTCAAGGAGCTGCGTCCAGTTGACTCCGTAGGTATAACATTTGCTGTAGACCAGTTCGTCGTTATCCTTGAAATAATTATTTCATCAGTTATTTCAAAATATATTTAAATAATAGAAGGCATAGAATATAAGGTTTACCTCTCCCCCATTTCATTGTTAGCCCCTTCGATTACTCATCGAACCACCCTCGTATCGACCCTTCA AGCAACGCACAATCAATGGGCTGACTTGATTGCCTTAGCCTCGGCACTCGTATGGCTGCAATTACTCACCAGTTCCTTGGGTATGGACAGCGATTTTCGCTGCTCCAGGGGCAAGTCGAGTAGCTCCGGGATGCGACACCAATAGTCATCCGGAGTATCAGCCATAAACAACTGGTTAAACGCACAAAAACCGCACGGTATGCAGGCGGGCAGGCAAATTCCGAAAACCAAGAGCTTCTGGTATTTGCCGAATTCGCCAATGGTGGGCAGAAGGTCGTCCAGATCGAAGGCCTCCTGGAAAGAAAACAGCAAATCTAGAGAAGATCAAGGACCGTGTCTCACAGATATGCACATCCACCGAGGGCTGGGATTCGGGCTTGTGGCGTTGTCGCAGCTCCGAAAGTTCATCGTATTCGTCCCCATCGTTGTCCTCAATATCTGACATGGATGCGCCTCTAGACAAGCTCTGAGCTGGAAATGTTTACTCACACTGCCCGATTGGCTCAGCTCACGGAAGCCATAGAAGCAACCACTGACAACTGTCAGTTGTCTAGGGTTGAAAGAATGAGCTGGTTCTGTTGATAGTAAAAAGTTTGTCGCAGTGGGCTCGATTCGTAA


Search Again