CR00547

CRIMIC CR00547

Gene CG12118

CG12118

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78946

Images

Construct Sequences

sgRNA sequence
AGTTTAGCACGTTGAAAGCTAGG

Amplicon 5' Amplicon 3'
AGCTGGAGCAACTCAACCTCGATGCAGCTGCCGTCGACGAGCTGAGTCGCGTTTACGAGGACAGCCGCAAGGATCTAATTCTCCGCCAACTGCAAATAGGCCATAGCTTTCCGCACATTACCGACATCCAGTGGCGCATCGTGTGCGACGTGAAGTCTTCCACCTCGGACTGCAGCACGGGCGCGGCCTGCTTCCACATCAATCTGGGCAACTTTCGGCAGAGCAGCGGCGAGCGGGTGACCATCGTTGAGTTTGTCTGCAATGCCGAGGAGCTGCAGTCGCTAATCAATCGTCTCAAGGAGATCGAGCGGCACTGCCAACAGATGGCCGTGGTCTAGGGAAACAAGCTCTTCAAATTCTTATCGATTATATTTCGCAGCATATAACACCAGCATTGTCGGCTATATACAGTGTCGGAACAGGAAACCTAAACAGTTAACACAGTCATCATCGCTTAAAAGGCTACGGCTTCATCATTTGGAGTCCAACTCCAATGGCAACCACTTCGTTGATCATCCGCGTCAATGGGCAACCTTGTGCGGCGGCGGCACAAGCAGCTTCATCAGCTGCCCATAGTGATTCGGCGCTGTGCTATAGATGGTGCCCGAGAAGCGGGTGCTGTCGTTCTTCTCGGCGGAAATCACTGTGCAACGGTTCTGTTCCGAAAGCCGCATGTTTAGACCACGGAAGCGTGAGTCCAGCCTGTATAGATTAGCCCCTTCCCGTGGTAGAAAGAATGGACGTCCGCTAAACGGATTCATGAAGTCCGCCCAGTAGCCGTACGATAGCAGGCGATCGCACATCTCCCGCGCTGCCAGGACAAACTGCAAAGGTAGTTGGCATTAGTTATGTATGTAGATATACTCGTTTAGATAATAGGTAAATACCAACAAACTAACTTCTCTGTATTCTCATTCATCAACCCAAATCTAAAACTTATTACAAATGATTGAAAATGTTATGGCTTACTTTAAAATTGGGTGCCAAACTTAAGGAAGGTCAACCCACCTA ACCCACCTAGCTTTCAACGTGCTAAACTGGTTTGATTGTATATAAACAAATGATCAGAGCAATAACGAGGTCATTCCTCCAATTCATCCAAATACACTGCAGTGTGATTTCCCGCTACAGTGTGGATGCGTGAATAAAACTGATTTCTCACCTTGGCAGCGCCCATTTCGATGTCTCCTTCGTGGCTGAGAACAAGCATGGTGATGTTTATGCACTGCTGTGCGACGACGGGTACCGGGAAGATCTCCAAGAGTGGCACACGGATAAGCAGGGGACACTTACAGCAGGTGAATTCCAGGCGCGATTTGTCCGTATTGGGACCCTTGTGAAAGTTAACCAGGTGGCCAAGCGGCTCGAGCAGACCGACGGTGGTGCTGTCGCCCTGCCAGGCGGGCCCAATGCCATTTGGCAGATAGAAGCGATTGCCTCTTTCGGCGGTCAGTTCCCAGTTGGGCTCACTCTCCAAACTATTTAGCTCATCGTCGTCGTCGAGATCCCGCGACTTGACGGTCTTAAAGTATCCGCCGGCATCC


Search Again