CR00546

CRIMIC CR00546

Gene Ent1

CG11907

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78945

Images

Construct Sequences

sgRNA sequence
CTGGGCCAAGCGCAATTCTAAGG

Amplicon 5' Amplicon 3'
TCGACATGACCTGACGCAAAATAGGCTCAAGCGGCAAGCCCTCAGCGCTTCCATTCCGGTTGTGCGAGGGCACTGCCCGGATGACCTTGTACTTGTCGCCACCTTCGAGATAATACCTAAAGAAAGGCTTTCGAGCCAGGATTACGTAGCACACAATGCAAAGCAGGATGAGCACTCCTCCCACAATGAAGAAGATGAATGCAGTGGTATTGGGACCCGTGTCGAATGCAAGCACAAGAATGAAGGCCAGGGCTGTGAGGATACCACCAAGAGCCTGTCCGCTAACCACAGCGGTGATAAACTCGGAGGGAAATAGACCAGCGACTCCGTAGAGGGCTCCCGACATTGTAGCCGCAGATACTATATATAATAAATATTAAGTAAACACTCAAGGAGTACTTCATGGTACCCACTATTTAGCAGCACTACAATGATGAGAGTGATTAGGAAAAACTGTTCCTGCCACGTGTCTGTGTTGATCTCCACGAAGCCAGTTGTAACCCCGAAAAGGATGAGGATCATCCACAGCGTTCCTAACATCTTGGTGCGCAGGGACACATGGTGTCCGAAAATGGCGTTTAGCAGCAGAAATGTAGTCCCAGAAATAGTGGCCGTGAGAGCCAAGTCGCAGGTAAAACTCTTCTGCAACGGGGTGAGCTCTTCCTCCAGGTCTGTGTTATTAATCGATGCATTCCGGAACTTGTACTTCCAGTACTGAAAGAGAAGCGAACAGGGTTAAAGCGTAAGTCAGCGGAAAACAAAGAAAATCAAAAAAGAGAGTTTTCGTCTGGGTGTGGGTCGTAAAGAAACGACGACAAAGCTGATAAGCACCGCGCCTT CCTTAGAATTGCGCTTGGCCCAGTTGTTCAGCTGTTTGGAATTGATATGTCCGAAGTTCAGTTAAATTGACTAGGATGCGGGTGCGGAAATTTCCACTCGTTAAACTTACATCTTCCGCAGTCACAAAGAAATTCCACGGGGTCATGGTACCAATGCCCAACAGGTAGAACACGAGGTAGGTGAAGAGTCGTCCACTCTCGGGTTCGTTGGACACCAAAACTACCTCGTCCTGCTGGCGTTCCATGAGACATTGCTCATCCGCATGGTGGTCCTGCGGACGAAAAGCGGGAACGAAGCTGCCCTCCGTGCCCAGAATCTCGTCATCCTCGTCCAGGGCGTCCACCAGTCGTCGTGTGTCACTGGTGCCTGGCATTGCCACTGAATTGCACTACTGTTTTGTACGCAGCCCTTGGTATTCATAAATTTACAACACCTCTGGCGGATTATTCACATCTGTAATTGTGGAGAAGTATTCGATGTAACTTAATCTGATGCAATTTACTTTCATGTGTATCATTTAGCACGGACGAACTGCGTAACATAAAAACGAATTTGTAAACAACAAAGCAAGACATTATACAAAAAATATCGATGGCTTATCGAGAGGAATCGATTAAATGAAAATATCTAAGATATCGCACTAACACCACAAAACCGTTCACCCAGGTTGGCAGCCCTTGGCGCGAAATGTGATGGGATTCAAACTGCATCTTAGTTTTGCATCTTAGTCCTATATTTTAGAGGACTGTGAAATTGGATTTTATTTGCAAAACGAGCGTAGCATCCACCTCAAATCGTAATTTAATTGCCAGCCAGAGCAGCAACAATAAAAACACCAATATCAAGCAGACCCTAGAGCTGATGATGAATGAACGCAATTTGTATTTAATCAATAAGCACGCCCCGCAGTGTTTTAAATCAGCGCACAGCTTCGTTTTACGGCTTAGCGCCATTCGCAGGATGCGATCCGCCCTCCACCCCTCGCCCATTGATCGCTTGCGAAATTTTAATTGGATTTGCATTCGCGTTCGTCCCGAAACCGGTTAACACACGCTCCTTCCCTCTGGACATGCGTTTCCTGACCCCCTCACTG


Search Again