CR00545

CRIMIC CR00545

Gene Cyp4e1

CG2062

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78944

Images

Construct Sequences

sgRNA sequence
ATCGAGCGATGTTATCTAGAGGG

Amplicon 5' Amplicon 3'
CCACACTGAACCTGGGTCTCGTGATGCTGGGTTATAACGAAAAGGTGTTCAAAGATCCCCACAAGTTCCGACCTGAGCGCTTTGAGCTGGAGAAACCAGGACCTTTTGAGTATGTACCCTTCAGCGCTGGACCCCGAAACTGCATTGGTCAGAAGTTCGCCCTGCTGGAGATTAAGACTGTGGTATCCAAGATCATTAGGAACTTCGAGGTGCTTCCTGCTCTGGATGAGCTCGTCTCTAAGGATGGCTATATAAGCACCACTATTGGACTCCCTGATGCCGAGAGGAAGAAGCGCGATCCATACCGTCACAAATACGACCCTATTCTTTCCGCTGTGCTGACCCTGAAATCCGAAAATGGTCTATACATTCGGCTGAAGGAAAGGCACTAAAATGTCAATTTATTGATCTCTGTTAAGTTTGGTGCTTTAATTTTGCATACCTGTGTTTTTTTAGGTATGCCGTCCCCACAGATACAATTATTAGGAAGCTGTTAATCACTTTGTCTCATACAACACATAAAACTTTTGAAACAAATCAACTCGTTTTAATCTTTGAACCATTGAGACTATGTTAATTAGCTTAAAAAATTTGAAATTATAGTTTCCACACGTGTAAGCCATTTTCAAGAGAAATGTTCATCAAGAAACTTAGTCGCAGCATATAGAAGGTCATGCTGAGTGCCCATATATTAGTTTAAAATTTGGGAGATAGTCATAGGCTGCTTCTTATGTGTGGATGTATATCCAAGCGCGAGAGACTGAGAACTGTCTGCCGCAACCGGTTGAAGTACTGACGCAGAGAGTCTTGAGGTTTCTACTCAAATCCGATTTACTCGCTGCACCGATCGGTTGTCTGTGGTCGCATTCAAAATGTGGATCGTACTGTGCGCTTTTCTTGCCCTTCCACTGTTCTTGGTGACCTATTTCGAGCTTGGACTACTGCGGCGAAAGCGAATGCTGAACAAATTCCAAGGCCCAAGTATGCTGCCTTTGGTGGGCAATGCTCATCAGATGGGAAACACTCCCACAGGTAGGTGCTCCATCTAGACAATCTCAATGTGTGGGATCAAAGTCCCC TCGCTCGATAGGTGTGACTGATCACATAACAGTTGTGTACGAATGATAACACTGAGACTAAATATACTAAAGGTCACTGCAGTACCGATCAATGGGATTAACTTAACAAATCTTCGTCAGGGAATTCATCCGTCGTTTTTTGCTGTATTAAAGACTATGGCTTCTATCTAATTGTAGAGCAAGTAATGATATGTTTTAACTTTGCTCTCCAGAGATTTTGAACCGGTTTTTTGGCTGGTGGCATGAGTACGGCAAGGATAACTTTCGTTATTGGATAGGTTACTACTCCAATATTATGGTCACTAATCCCAAATACATGGAGGTGAGTGTGACATGTTAATAACGCTAAGGCGAGGATGGTAACAATGCAGCTTTTGCGCAGTTTATACTTAGCAGTCAAACTCTGATATCCAAGTCCGATGTATATGATCTTACTCACCCATGGCTGGGATTGGGCCTCCTCACCAGTACTGGCAGCAAATGGCACAAACACCGGAAGATGATAACCCCAGCCTTCCACTTCAACATCCTGCAGGACTTTCACGAGGTCA


Search Again