CR00541

CRIMIC CR00541

Gene Gba1b

CG31414

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78943

Images

Construct Sequences

sgRNA sequence
ATTGACCTAAGCGTGTCTGCTGG

Amplicon 5' Amplicon 3'
GGGATCACCTTACTGGCGACTGTAGCTACTATTCGCCGGTCCGGCTGCTTTATCAAATCAACAACCGAGCCGGGTCAAGTGGCGTTCGAAAACATAAACATTAAATTGAGTGAAATTCGTTGGTTTGATTATTCGAAAGCAGTCCGGCCTGCTCTCGTTTCTGAGCTCAGTTGTGGACGGGCCTTCGAGCGGGACGCATTGTTTTTGGCCCGAGATGCCAGATATGAAGACACCACTGCTTGGCTTTCTTACTACAGTGATCGCAATCTCTGCAGGTATGTGAGAAAACAATAAATTCATGCCTACCTGGCCATGAGACTCCTCAAATGAAACGCATTGCAGGTGCTCCCGACTGGCAGTTGCCCTGCGATTTGCGCGAAACGAGCCATGGAAGCGTGTGTGTCTGCAACAGCACCTACTGCGATTATCTGGAACCGCCCCAGCTCACTGATATCTCGCAGATTGTGGTGATTAGCTCCAGCAAGGTGAGTCAGGAGGATTGTCCGCACTCGCGGTCACATCATTAGCT CAGCAGACACGCTTAGGTCAATTATTCCGATTAGATTCAAAGTCTGTTTGGAATAGTTCGCTTTTCTTCTGTGGCTTGTCATGTCTAATTTATTGCTAAACGAAACGGATTTAAATTTGATTAGTTTTATATTGAACACATAAAATAATTGCGAACATTGGTTTATTGAATGTAACTATTTTCATAGGATGGCTTACGCTTCAAGAAGACGACAGGGGATCTCTCGAAAAAGAAACCCATAACAATAGATGACAAACAGTTCACCGATGAGAACTTCAAGGCAGATGCAATTGTTGTGGATCAGGAGAGGGCCTGGTTGCAGTTGGCCAACATTCCCCAAAGCCTGTGTAACTAAAACGCTTTATAAATAGTTTATAAAAAAAAATTATATGCCCAAGGAACTCTTGAATAATTTTAGTTATTAATGCCAGCATTAAGACATATCGCATATTCGTGAAACGAGAGCAGAGTTTTCAAAATGTCTCCATTTTTGGTGGGGCATTTACAGGAACAGTCTCGTACTTACTCAAAGAACTTCCGGTGGAGCTACAGGATCATGTCTATAGGTGAGTTGGATATTAAGCAATAAACATATATATTTAACTAGTTATTTTGCAGATCCTATTTTCATCCGGTTGGAATTGCTTACAACACTATACGAATGTCCATTGGCGGTTCCGACTTTGATATGGAACCCTGGGCATACAATGAATTGCCTCTTCATGATCCGAAATTGAGCAACTTTACCGAACTCGATCCGCGGGATCTGCAGAAAGTGGAACAGTTGAAACGCCTTAAGATCATCGGTAAAGTAGATTCTCTGAAAATCATGGGCGCTGCCTGGAGTGCTCCAACCTGGATGAAGAGCAATAATCGCTGGACAGGATTCGGGCAGCTGAAATCGGAATACTATCAAACGTGGGCCCTCTATCA


Search Again