CR00540

CRIMIC CR00540

Gene CG9170

CG9170

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band80591

Images

Construct Sequences

sgRNA sequence
TTACATGTGTATAACGATTGAGG

Amplicon 5' Amplicon 3'
AATACCCTTGACACCGGACGGCGAGGTATATCCATCGCTTTCGAACTGTCTATGTGCCTTTTGAAACATCGATACTGTACCCGAAGGTTTCGTACCTCCTTCGTTCTCCTCTGACCTATCGGTTTTTCCATTCATTTGACTAGTGGGCGCGGGTTTATTCGCTATTTGTGGCTTTGACTTGGTCACCTCGAAGCCAAGCTGATGCAATCGACCCATATCCTTGGATCCAGATTCCAAAAATCGACTCTTGGCACTACTAAATAAGCTGGCCTTGCTGGCCACCGACCATTTCCGGGCCAAACTGTTCAGGGGCAGTGGACCCGGCGATGGAATATCATCGATACCCTGCATGCTGCGTATTCCGGAGTCCAGTTGCGACAGATCATCGTTATCCCCCACCGAACCCGTGTCCAAAGGCTTCTGGCGCGCCTGATTAACCAAATCGCGATATATGGCATCTAGTGGATGGTCCCATTGGGACTCTTTGGTGCGCGTATTATGGTAGTAATGGCCATTCTTCTCCTCCGAGTAGCTGCCATGAAGTCATCCAAAATATAATTACTTTTGCATGCATTTTCAGTCATCTTGCAATCCTTACCATATCTTCCAGTCTGTTGGCAATGCGGCCATCAATCCTTCCTTGGCCAGATAGAGCAAATGCGGTTCCTTCTGAGGATCGATTCCAATCAGGGAGGCATACTCATTGATTTCTGTGCAGGAAAAAATGGTATATACATATTTAAATAAAAATTTGTTGCACAACTTTTAACAATTAATAATGAAATATGCTCTCAATATATTGTTTTAGCATAGTGAAGGAGATGAAAATGTGTTTGGTAATTTTTACAGGCTATAAAAAAAAGACGATAAAAACTAGTATATAACCCTATTTTATATACATATATATTTTTTTGTAAAATTTTAAATTTCTATTCTTTTGATTTTCTTCTTTATTTTCAACTTGAATATATAATATATAATAAAATTGATTTTTGCAGGATAAAAAATGTCTTTCATTGATGTATATATATGTATATACCTAAGAACATATGTATATGCTCCAAATGGTCAACACGCCTACCTC CGCCTACCTCAATCGTTATACACATGTAAGAAATCACTTTTTATTGGATTCGAGGCAAACGAATTGCTTGCCAAACGTGAATTTTCACCGGAAAAGCCGATATTACATACTCTCACCCACAATTGGGGTAACTAGTCAACGGAACTTACCCTCCGATGAGGGGAAACACGCCTCGTCGAAAACCTCCTCGCAGATGACGGACGACGAGCCCTGGGATGATGATGATGGTGTGGCTGGGAGGGATTTGGTTAACTCAGCGGACGCCGTGCTCGAGGAGATCCTCTTGCACACGCTGGTCGTCGTCATAATGGGTACTTTAACTGGATTTCACTAACCGAAGAAACTCGAGCGGAGCTAGCGTTTTCGTTGCTCCGGGAGTTATCCGTACTCGAAGTGTCGTTCAATATATTTGCATATATTGTTATACTTTTCGGATTTGACATTCATAGTTCTCCATACTATTCCTTAGCGAGTCCTGCCGACAGCGGAGCAAATGCCAGAATAATCGGATGCAGTTTGACCTAAAAATGAAAATACAAATACCTACTGAGTCATCGCTATACCACTCAGTATGTGCGTGTGTCCATGTCGGAGCATGCTCCGAACGTGGGTTGCTGGCCAATTATCTGGTTGGCAACAGGATATTGCAGCGAGTTTGCGTGTCCGCGCAGCCCGACGACTCCCAGGTTCCAGGTCCCTGTCCTTTCCACCACGAAAGCAGACGAACAGAGCCTCAA


Search Again