CR00538

CRIMIC CR00538

Gene Ser7

CG2045

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80590

Images

Construct Sequences

sgRNA sequence
GAGCGTGGAAAACTGGTTGATGG

Amplicon 5' Amplicon 3'
CGTAGCTAATCAACGCAGCGTCGGCGATGGAAAAGGCAAATCAAAAGCCAATCTCTGAGATTCAAAAAGCTTCCGAGGGTCGCGGCTTGAGGTTGCCGATCGCCAGTAGATCAGTAGTTGATTGCCAGCCACCGGGGACGCAGCTTTGCTAGCGACTCGAGAATCAATCGGAGCGGAAAATAGGAAAATAGAAAATTGATAGGAATTAGAAAATAGGAAAACCTCGCAAAATGCTCCTGCTGATACCGCTTTTCCTGACCCTTTTGGGGGCTGAGGCCCAGCAATTTGGCAGTGAGTTTTACTCAAGACCACCGCTCCTTCGAGATTTCCTAACCCATTTTCAATCCTTTAGAAGCTATCATGCATTTTGGCAACTGCAACTCGGTGGAATTCGGTAGGGGCACCTGTATCGAGAAGAAGGACTGCGACTTTTATGCCGTAGATAAACTTATGGAATTGGCCAGCAAACAACAGTGCTTCTCCCGCCAGCGACCCGATCTGGTAAGTGGTATTATATACTATATATATGTATATATTCGCCCGATGTTCAGCAAACACGTTTCCCAC CAACCAGTTTTCCACGCTCCGTGGAGATCTTCTTCACCTGAATAATGCTATTTATTAGCATTAACAGCTATTTTAACAGTTTATTTACGTCTTACTTTGCGATTTGTACATAATTGATTGTAATACATTTTTTGATTTAAACGGAAATTAGAGAGCTATTAAAAAAACTAAAACGGCTGATATACCCATAGTAAAACAACCCAATCTTCACTTGAGCTTATAGTTTTTATTTTCCAAAAATGTTTATATATACAATGCACCATAATATATATATATCTTATTTATTTCCCATTAGGTTTGCTGCCCCCGCGAGACGAATATTATACCGCCATTGGCACCCAGGATCAGTAATGGGACCACTAATGCCACGAGCAGCACCACAACGCTGAAACTGCTGCCTCGCACCACGCCACGCCCACCCAGCGGTATCGACCAACTGCCCGAGCATCCGTACTGCGGCTCCGCCTTTTCGTTTCGCTTGGTCGGTGGTCATAATACCGGACTCTTCGAGTTCCCGTGGACCACTCTGCTGGAGTACGAGACAGTGAGCGG


Search Again