CR00537

CRIMIC CR00537

Gene Lnk

CG17367

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78942

Images

Construct Sequences

sgRNA sequence
CCACTTCAGTGAGGTCTAATCGG

Amplicon 5' Amplicon 3'
AGCACAGGAGCGAATACGAGCGCCTTCAGCGCTGGCGGTTACATTGGGCCCACGTCGGCCAGCAGTCATCACAGCCTGGGAACTTCATCGGCGGCAGCGGCAGCAGCAGCAGGAAGTGACCTGATACCCGCACCAATTGGCACGGGCAACGCCATGGGAGTGTCTTCGTATGCATACGGTGGAACCAGTTGGGAGGAGTTCTGCGAACGACACGCCAGAGTGGCTGCCTCGGATTTCGCCAAGGCGTGCATCACGTACATTAATGGCAATCTGCCGCCGGAGGAGGCGAGGAACATCCAGCATCGCAGCTTTGCTCAGAAATTTGTGGAATCCTTTTCGGCGCACTACGACACGGAGTTCTTCAAGCGGAGGAGCACTCTTAAATCAGGTGCGGGCTCGCTGGACTTCGAGGAGGAGCACGAGGTGCCAAAACTGCTCTCAAAGTCTCTATTAAGACGACTATCATTCAAAGGACTGCGCAAGGGCAAGGTGAGTTGATGCTCTTCTCAAATCCTCTCGAAATCATTGAATAGATTGATTTTTGATTATTTCGAGGCCACACTTGATGCTTATACTTTTTTTTTAGACATGATTGTTGTTTTCTGTCCGATAATACCCATTAAGAAGGTCACGAATCACGAACTAAAAGTATGCAGATAAAAGCATTCACTTTAGCATTCTTTGCATTCTGTCCATAAGTCCGA AGTCCGATTAGACCTCACTGAAGTGGTATTATTATCTTCTATTTGATTTGTTGAATACGTCATGATTATCAGAACATGCTGTCAATTATGCAAGTCTTTCTTTCAATTTTGCAGATCATGAAGTATTTCACATTGATTAAAAAGCTTTTCAGTGCCAGGATGTTTTATAGTCGGAAACTCCGGCTATATTGTCACCACTTGTTTTAACTGTCAAAGATCTCTTTGCTGCAGGCCTTCTTCCACAAGAACTCGGATGACTTGGATGGCAGCGGTGGCAGCGGCAAGCAGAGCAAGACGAAGCTGGCCAAGATCGTTGTGGAGTGCCGGAAGGAGGGCACAGTGAACAACCTGACGCCGGAAAGTCTGGATCAACCGACGGGCTCCCAAAAGTGGGAGAAGTGTCGACTTGTACTGGTCAAGGCCGTGGGTGGCTACATGCTAGAGTTTTACACGCCGCACAAGGCGACTAAGCCGCGCAGTGGAGTCTTTTGTTTCCTCATCTCGGAGGCTCGCGAAACAACGGCACTTGAGATGCCGGACAGGCTGAACACATTCGTCCTCAAGGCAGACAACAACATGGAGTATGTGATTGAGGCGGAGAGCGCGGAGGAGATGCGGAGTTGGCTAGCCACAATACGGTACTGCATGCGAACGCCACCCACTCAGCAGCCAACGATCGAGTCGGATGGTGTTATGGCGTCCGCCATGCAAACATCGCCGACACTTCCGAGTCCCAATCCCATTGGTGGGATTCAGAATCCGCAGTACCAGCAGCAGCGCGGCTCGAATGGCAATCTGGTGGGAGGTGGAGCTCCGCTCACCTCATCGCTGTCTGCAGACAGTGCTTTGGGCCAGGGAGGAGCCACTTCTGCCAGCGAACTAAATGTCATCAACGAATTGGGCACCTCACCGACCTCCGGGCCACCTGACATACCTGTAAGACCCCATCGAGGTGAACAGCGCCTGTCCGCCTCAAGCAACTTCGATGGCATCGAGGGCACGGAAAATGATGCAGATGTGGCGGATCTGACGGCTGAGATGAGCGTGTTTCCCTGG


Search Again