CR00536

CRIMIC CR00536

Gene CG31743

CG31743

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80589

Images

Construct Sequences

sgRNA sequence
ATTCAGCTCGTCATATGTTGAGG

Amplicon 5' Amplicon 3'
TTCCCTCGGCTTCGTTCTTCCATGAAGTCGTAAATTGTTTATGTTTACCCTTGGCCAATACCCTCTCCAACAAGCCCCTCCCCCCTCCCCCTCCAAAAAGGGGGGCTTGCCACTTTGGTCGGTAACTTTATGTGACCATCGCGTGTTGCTTTAATGGCCATAAAGAAATTGCGTTAGATGTAAAATGTTGCGTTTATCGCTTACGTATTGGGAGGTTATACAACATTTTGCAAGCCCTTTTAGAGATTCTGAATCCTATATCTATCCGGTATCTGATTCTAAAAAATCAAAGACTAACAAGTCGTTATTACATTTTATTTCATCTGGCATATTGACTCTTCCCTAAGTTTTGAAAGTTGTTTAAACTCAGTGCAAGCTGACTTGTTTAAAAATGGAATAGTTGTCTAAGGATTTGGATTATTTAGAAAGTGTTTGTAAACAGTCAATCATTTCAGATAAGTGACGGGAAATAGCGCCTTAACTGACGAACGCTTTTCAATTTTTGCTTAAAATAACATTGTGCATTTCACTTTAGATCGACATTTTGACATATCTTAACCTCGTCGCTGATCTTTTTGTGTATTTCTGTATATTGCCTCACATTTTACCTACGCTTTCCACTGGCTAAACGTACACTGAATTTGTTTGCTTTTGTAATGTGAAATGTTTTTGCGGTGTTTAATTGGGCTCGACATTGGCCGCCCAACGAAATGCCTTTGTATATACACTCCGACTCGTATTTATGTGCTTAGTTTGCCTAGTTGTTAGTTCACTTTAACAACTTGACTTATTGCCCAATGCCTCCTAGTAGGGAAACCCATCCGGCCATCTCTTTTAGTGCAGATTATAATTTATTGCACTTGGCAATTAAAAGCAAAGTAATTCAGCTCGTCAT CATTTAACGCTTGACCCCCGAAAGTCGCAATAAAAATTTAATTTTAATGCCGGTTTCTCTTCACTCTCGTTTCTCGAAAAAGAACTTGAATTTCTTTTGATTTTTATAGTCGCGTATCAATATATATTGAATTGGCTTAGTGGCCTCAATTTCACTTCATTTAGACTTTATAAAATTCTCATATCATCTGCAAGTAATAACAACTTTCTATAAAGTACATTAAGTGCTTAATTTCGATTAATTACTTGTCTAATCACACTAGATTACTGTGCCAGAACACTTTTAATTAAGTAAATCTATTAGAATTTAATTACAATATAATTGCCAGTCATTAAATATAGCCAATTCATTAATATTTCCAATGCCTATCAGTAAATAGTTCTGAGGTGAGTGTGCAGGATGACACCTGCTCATAGATAAATCAGTCCATTATCTACACAATCCACTCATTAACAAATTTTTTGGAAAAAGGGTTGATGTATTCCTGCTTATCGGTGCTTCCCTATCATTATGTTCACTCGCGAAATGCTCAAGAAGCGAGTGATTCACTCCTCCACCCCCAAAATCGTTTTTCAATTTTTCAAGGAACGTAACCTTCGGTCTGAAATTCTTCATAATGTAAACGAAGAGGAATTATTTTTCTTGTTTATTTGGTTTAATTGGCCGAAGAATAGTGTTCAACTAAACAAATCCATGAATATGATTCTTCGTTTTCCAGGTTGCCTGCACAAACTGGAAGCGTGTGCTAATGATGCTCACAAATAAGTGGCACAACGGAACCGATCCCCTCCAGATTCCCGGATCCCTGGCCCACTCCGTGGGCATGTTCACTAAGCTCTACGATCTATCCGAAGCGGAACAGCAACAGGTTCTCAGCGACGAGTATACGCGATTTATCCTGGTGCGACATCCGCTCGAGCGTCTTCTCTCCGCCTATCGAAATAAGTTGGAGGGGGATTCCCCCAGTGCCCGCTACTTCCAGTCGCGCGTTGGGCGCCAAATCGTGAAAGAG


Search Again