CR00530

CRIMIC CR00530

Gene CG3078

CG3078

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78941

Images

Construct Sequences

sgRNA sequence
AAGGGGTGCCCTGTGGTCATTGG

Amplicon 5' Amplicon 3'
ATAGGCGGGTAGAAGGGTGTAAATGGAGGCGTACAGGTGCGACAGAAGAAATAGGAGCACTGTCATATAGTTTGCCACAATTAGTGGCCCATAACCATATCGTTTCATCAGTCGAATGCTGGGCAGGCTCATACCAGCGGCGACCAGGAAGAGAGCACTCAGCAGAAGGGATCCAACCTCCGGACCGAGGGGCAACCATTCCTCCCGATGGTGCCACACCGCATTGGAGCCCTGGAGCGCCATCACCGGCAGCAGAACGCAGTTCATCAGTCCGTGGGCCAAGCTTAAACAGCTAAACTGGCGCCACACTTTTTGGCGCACATGGGCTGGCACCTTGTGCCGGCAATTCCTGTTGTTCAGCGTTATCAATCGCCGTATGGAGGTGGCTCCAATGGAGCTGTTTATGGACTCCCGACGACGAGAGGCCGCCAGAGCAGCCTGCACCTGGTACGAGGACACCGGATTTATGCGATGCGACCTCGTCGAAATGGGTGACGGCGAGTATGTGGTGAAGTGCTGCTGGAAAAGATGCAAGAAAAGGGTATTAGGATATAGCAAGAATCCAATCATCTGGCAGGCTAATGGTATTACAGCCAGCTACCTTTCACTTTAACAATAGCAAAGGGGGAGTAGTCGGAGTAGGGAAGTAGTTGTAGTTCAACTTGGAAAGAGAGTCCGTGTCCGAACACTCACCTTTCACGACACACCA ACACACCAATGACCACAGGGCACCCCTTTTGTGCACACATCGCCACATGATAGTTGAGTGTCCAGGAAAAAAGGGAGATAAGCTCCCAGATTCTATTTATATGCGACAGGTGTCACCATGCCGGAAAGCAAGTGACATGAATTATATAAAGGCTTTTCACACAGAGGCGGACTTTTTATGTGTTCACCTGAGAACTCACCTCCATCATCTGCTCTTCCCAGACGTTCTGGGCTCCTCCTGAACTGCGGGTTCGAAGCACTCTGTGCCTGGTGGTCAGCGAATGGCGGTGCTGATGGTGCTGGTGCTGGTGCTGATGCTGGTGCTGATGCTGATGGTGGTGTGAGTGTGGGGCATACTTCTTGCCCAGTCCCAGCATCGCAAAGCCACTGGTGGCCACCGGAGCTCCCGAGCTGGTGGCCAATCCAGAAGCTGGGCCCACTGCCTGGTTCGGACCCTTTCCGCCAGTTGTCCCATTGCCACCGAGCAGCTCTCCGTTGCCTGTTGCAGTTCCTGAGGTGGCATTGAGGCTCAAGGATCCGCCACCAATCCCCAGACCAGCCATTATGTAAGCATTATACGACGATTGCTGAGTGGAGTAGAAAAATACATAAGTCGTAAGGAGGGGGGATCTACTCAGGCGATCTCACCTTGCGCTGCTGAGCAAACGCGGAGAGACGCTCCCGCTCGCGACTGGTGTCCCGAGCCCGCTGCTCCAGCAGAAGTTCGTACTCCCGTCGCTTCTCCCGCTTGCGCTCCGCCTCCTCCAGCTCGTGAAGATTCGGCAGACTGCCCATTTCCGGCGATTATTGCCAACTTATCAAAACCTAGCGCCCGTAGTGCGAGTTATGTGGATTGTGGGGCCACTGCGAATCCAGTACTGCCATCGCTCCAAAACGGCGAACTCATGCTGCTGCTCCACGGGCATCCCATTCCAATCCAGTCTGCAATTATTGTCCTTGCTGCGTAGGCGGGTTCATTGTCCGCCGCCGACCTGCCACGCCCCCAATTCCGCGTATAAGGCTGTGTC


Search Again