CR00529

CRIMIC CR00529

Gene Cyp4e2

CG2060

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band79275

Images

Construct Sequences

sgRNA sequence
TGCGCATCGAATCTACTCAGCGG

Amplicon 5' Amplicon 3'
AACTCAAAACGTGACGGAGCGGAACAGAATAATCGAAAAATAAACGCACACTGTGCTGATATCATTTCTTAAATGTAAATGTAAATTTAAATTTGCAGTGGATTTTACCTTACGTCTGTGATTTCTACCAAATTTAAGTCTTGCTGCTGATAAGCTAAGAAGAGCAAGCGACTTTCTCTCTCTTCTCTTCAATTTCTGTAAGAGTAATCTTAAAAACATTTTGCAAACATAATGTGTTCATCAATTCTCCCGATTTCTCTTTCTTGTTGTGAGCGAATGTTTATCAACGTTTTGTTTTATTCCATTTTTTGCTGCCATAAAACAATATATACTGGATACAGTTTTAAAAAAAGTTAACTGTTACACATTTAAGCGCAGTCTCGAAAACTATTGGTTCTCCATCTCATCTAACGATTAATCAGGGGGCTCATCTTAAAAAACCTGATATTGATTCGGCAAGTCATGCTGAAAGCACCAAAATATATACTTATATTCGGGAGACTACAGTTGGATTAGGAAAACGGCAGATAAGGGAGCAAGCGACTGGGGAGCTGGCTGATATTGGTATCTCTCGTATTTAAACCGCCCGCCGGCCCAAATAAGCTCTCATATTTCCAGTGATTCGCGGGCTGGACGGTTGTCGTGGAACTCGCGATCGAAAATGTGGTTCGTGTTGTATATTTTTCTGGCCCTACCACTGCTGCTGGTTGCATATCTGGAGTTGAGCACATTCCGCCGGAGAAGAGTGCTTAACAAGTTCAACGGCCCCCGCGGCCTGCCGCTGATGGGAAACGCTCATCAAATGGGCAAGAATCCGTCAGGTGGGTTTTTCATAGGAGCCGGAAAAGTCGTAGCGTTAGCCACGCAGAGGACACACCTGAAATTACCCATCTCGAATAGCGTTGTGACTGAGGTAACTGCGCATCGA GCGGCGAGGCTATTCAAGTAAGGTTATTTTGGGCCAGCGACTTTACGACCGGAAAACAAGGGTGTTAACTATCAGATAATGGGGCTACTGGCACTTGTAGAAATGGGCTAATCGTAGCCTAGGTCGAGTATCGCAAAAATAATGACGAGGCTTTGATTTGTGTTGTGTAATATACGATGTATGTATGTATGTATTATACTGCACTAATGAATACTGAAAATCGCGTGCCAAAAACAAGCAATGATTATCTACGGAATACCGATATTGGTACGCGATCCGCCTACTAATGGCATTTTCTCACGTCTATATAGAAATACTCGACACGGTTTTCTCCTGGTGGCATCAGTATGGAAAAGACAACTTCGTCTTTTGGATTGGAACGTATTCTAATGTATTGGTCACCAGCTCCAAGTACCTTGAAGTGAGTTACAGCGAATTTCCACCAATCATGTAATCATGTGACTCTATTATTTTCGTACTTCTTCAGTTCATACTCAGCAGTCAGACGCTGATCACAAAGTCCGACATTTATCAACTAACACACCCTTGGCTGGGATTAGGTCTCCTCACCAGTACTGGCAGCAAATGGCATAAACACCGCAAGATGATCACCCCAGCATTCCACTTCAACATCCTGCAGGACTTCCACGAGGTGATGAACGAGAACTCCACCAAGTTTATCAAGCACTTAAAGACAGTTGCTGCCGGGGACAATATATTCGACTTCCAAGAACAGGCCCACTATTTGACCCTGGATGTCATTTGCGACACAGCGATGGGTGTGTCCATCAATGCCATGGAAAACCGCAGCTCTTCCATTGTGCAGGCCTTCAAAGAGTTAGTTTCGTACCTCGTAGTCGAACTATCAGATTGCATGACTCTTGATCCTTTTCAGCATGTGCTACAACATCAACATGAGAGCCTTCCACCCGCTGAAGCGCAATGAACTGCTGTATCGTTTGGCTCCGGACTACCCGGCCTATAGCAGGA


Search Again