CR00527

CRIMIC CR00527

Gene Trxr-1

CG2151

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78940

Images

Construct Sequences

sgRNA sequence
AGTGCGGAACGAAGACTGTTTGG

Amplicon 5' Amplicon 3'
GAATGCGGTGCTCTTGAACGAATAACCCTTTGCGGAATGTTCGAGAATCGCTTTATGATGATGATGATGATGATTTCACCATATCAGTCGGGTGCATTTATTCCCTTTATCTGTGTTTTCTATTTCGTATCTCTCGTATCCGTCGCTCAACGAGCGCCCGCCATCGTCTTTGATCTTTCATCATCATTGCTGAGCTGCGTCATCACCACTTCATTCCGCAATTAATTGCAGTGTGACGACAACAATTGTTTATTTGCACTCGCATTCGTACGTAGCCACCTGATTTCCCCCTGTTCCTGGCCAGGATTAGCATTCCGTCCGATAAAAGCGAATTGTGTGTGGTGTTGCCAACTAGTTTTGGGGCGTAACCATGACAAAGTCCGGCGGGTCAAAGCAAACCGAATGGGGGGGCGTAGGTGGACGGACGGAAGAAAGGCGTGGCCGGGCTGGGATGGGCGTGGCTTGGTGTGTGGCGATGTCGCTAGATGATTGCTCCACTTTGATTCGAACTCCCACTGACCCAGTGGCATGTGTGGCATTCGGCAGCACTATCGCTACCTGGCAACTGAAGCCAAGGAGCTCGACGGGATTGCACGGTGCAGATTACGGAT AGGAGGCCAAACAGTCTTCGTTCCGCACTTCTTTGGTCTGGATGCATCTGTTCGAATTCATACCGGCTTCCCAGTTGGTCGAGGGTGAACCACGCCACCGGAGGAGCATCTACCGATCCGCCTATCTGGACATACGACTGCGCGAGGAGTCCACCAAAGGCAGGCGGGGATTAGCCATAATCATGAGTGAAGCTAAAGAGAAACTTGAGTAGTTGGCACCACATGGCTAATTGATATCATTACCTATCACTGATAAGGATTTTCAACTAATCTAGATACTGGTTAAGAACAAAAACAGACCATGCCAATACAACATGGCTATTGATGTTACTAACGGTGATAAGTTTTTAATAATACAAGGTGAATTGGCTGTGCTACGATTAGATTTCCTGACGGCTCCTCATGTTCTGTGACCTCTTGACCTCTTTAAGCCCAATTTTGGCAGTAGATTACATATTTCTATAGACAAAAGGCGATGAATCAAACGAAAACCTTTTTTCTCCTGCAGGATCCTACGACTACGACCTTATTGTGATTGGAGGCGGCTCAGCTGGCCTGGCCTGCGCCAAGGAGGCAGTCCTCAATGGAGCCCGTGTGGCCTGTCTGGATTTCGTTAAGCCCACGCCCACTCTGGGCACCAAGTGGGGCGTTGGCGGCACCTGCGTGAACGTGGGCTGCATTCCCAAGAAGCTGATGCACCAGGCCTCCCTTCTGGGCGAGGCTGTCCATGAGGCGGCCGCCTACGGCTGGAACGTGGACGAAAAGATCAAGCCAGACTGGCACAAGCTGGTGCAGTCCGTACAGAAC


Search Again