CR00526

CRIMIC CR00526

Gene CG6012

CG6012

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78939

Images

Construct Sequences

sgRNA sequence
TATGATTGAAAGCCATGCAATGG

Amplicon 5' Amplicon 3'
CGCCGATGGGATTAGGAGACCACCCTTCATGATCTGCCTGGAGTACGAGTTGATTTTGGTAACCACAAAGTTCGGGGACAACATCTGCACATGGATGCCATAAGGCTTCGCCTCGTGGTACAAGGCCAGGGTTAAACTACGGGTGTACGCCTTGGAGGCGGCATAGTAGGCTCCATTGGGAAGTGGCTGCAGTTCCGTGCCGGAACCAACATTCACAATGGCTCCCTTCAATTTAGACGCCTTCATGCGCTGGAAGAAGATGCGAGACAGCTGGGAAACGGCCACCACGTTGGTGTCGATGATGTTTTGCGTTTCTTCCTGGTTATATTTCAGCAAGGATTTCGGCGTGGCGATTCCAACGTTGTTTACTGCGATAAGGTGAAATTGTTTATGCAAGTGAAATAAATACCACTTACATAAGTAAATGCTACTTACCAAGTATGGAAATGGGTATATTGGCAGTTTCCTTTTCTATGTGCTCATAGACCTGCGAGCCCTTGGTAAAATCAGCTATCACTATTTTGGTCTGAACACCGGCACCGCAATCCGCTAAAAACAAACAAAATGAATCGAAAAAAATGTATGTTACCAAAATTAGATGTCAATCGGCATATACTTCCG CCATTGCATGGCTTTCAATCATAATTTCGACAAGTGCTTTGCGTGTTCTTTAAAAATGTCAGTCTGTTGTAACGGAAACAATCCAAACTACAGTCTTTAAATGCAGTTAACCAAAATTTAAAGCTATTGAACTTGTTTGTTTAATTACTGGTATTTACTGGTATGGTAAGATTACATAACGATTAACAACTGTATTATCTTTTAACGATTATACAAAATAACTGTTGATAAGTCGTATTTGGCATTTTTAATCTCTCCACACCTTGACTTACCGATTTCCTTGGCAACCGCCTGGAGTTTCTCCTCGGTTCTAGCGATTAGGACCACATTGATGTTCTGGCGGGCCAGCTCCTTGGCATATTCCTTGCCAATTCCATCGCTGGCACCCGTGACAGCGGCCCAATCTCCGAAACGCTCCTTCAGAGTTGGCCTAGTCCCACTGAAATACCTGATTTTGATTAATTTGTACGGCGTTCTTAACTGCTCGTAGAGATAAGAGGACAGGGCATAGACACCAACGAATGTGAGGAATGCTGATAGGGCACAGAACATTTTGTCGATTTATTTAGTAATTTTAATCGACTGCGCTACAGCGGAAAGTACGTGTGTGTTATACGGTCGACACACTTGAACGGACTGTAAAAAAATTGTAAGCAAAATTGCACAGTATTCGCCGGGCAGGGCGCTGAATTTAAATGGCTTGAATTAATAGAACTCGGTGCTATTAAAAGGTGTTCGACTTGCCGTTAAAAATAGCCCGAAAAATTGTATTCATAATACAACTTTGCCTATTCAATTATGGTTTGCCTAATGGTTTGACTTGCTGTTGGCCTGGAAATGGTCAAATTAAATAGGCACATCCATTAACAAATATGATTGCATTACACTGGAAATGTGTGAGAAAAGTCGTGTTGGCGAGG


Search Again