CR00524

CRIMIC CR00524

Gene vanin-like

CG32754

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78938

Images

Construct Sequences

sgRNA sequence
GCTCTCGCAACCTCTCGAGATGG

Amplicon 5' Amplicon 3'
AGAAACTCGAGCTTGAGGCCACCTGACGGGTTTGGATCTCCTGTAGACTCCTCTTCGCACGTTTCTTCAGGGATCTACTGCGAGTATACTTGGGCACCTGGGCCACATAGATGGCCCTCTCGCCGGAGTCCTGGCGCATGACACTGGTCAAAGTGCCGGAACGTCCGTGATAGATGCCCGATCCACTATTGCCAATGGAGGGACGACTGGCTCCAGACGCCAGGAGATTCACATCGTTGGCATAGGCCCAACCTTGTTGCGTCTGAACAGCTGTGGAATAAGACATTTAACAAATGTAATATTTTCCTATTCGTTTTACTATTCCGAAGAATTCGCGTGGCAAGCATAAAAAGATAAAGCTCATACAGTGCAAACTAGACGCTTACTTTTTGACCTACTCATTCAGGACTCTAATATATAGCTCCTGCGATAAGACCTAGTTTATAATTACAAGCCATTGCTGTGCTGCTTAATCACCTGCCATTAGTGGCATTTTAGTTTTTACAGCCTTGATACCAACGCATAATCGGTTCCC CCATCTCGAGAGGTTGCGAGAGCCATCATCAGCAATCCATTGTCGGCGATAAGAGACACATGTCAGTGAACTAGCCCCCGCTTTCCTTATCGCCCATGTCTATATCTTACCCGTGAGGAAGGGCAGTTGGGAGAACCACATGGCCGGATACACGAAGTCCGTAATACCCTGCTCCACGATGAGTTGATGGGCGGGAGTGTAGAACAGGATGTCGAAGCAGATGAAATGACCGAAGGTGACCCCAAAGTCTGTCTCGAAGGTGATCAGCTCGGGCAGAAAAGTGCTGTTCTTTGCTTCACCATAGAGATGAACCTTTCGGTACCTGGACACCACGACTCCCTGACGATCGAACACTACATTGGTGTTGAAAACATTCAGTCCGTTAGATGCACATGGCCTCGTATCCTCGGGAATATCCTCGCACTTTTGCTTCTCGGTCAGATTGATCACAATGTATTTACTGGCATTGCGGGCCGCGCACGACAGGGTCACCAGAAACTCCTCATAGTAGGTGGCATTGGGGTCACTCAAACACGGGTTTATCTGATCCTCGGGATTGGGCACAAAGGTCGTGGAACCCGCGGAGTTCAGTGTGCTCTCGGGAAACACAATGATGTCGGTGGCACTGGCGTTCTCAGAGTTTATGATCTCCACATAGCCAGCAAGGGAATCCGACCAGGCCGATAGACTTAAGATCGACTGTTTGAACTCCACCACTCCGGCCGTATAGTAATCCGATTCGGCCAGGGCCGCCTGAAAATTATGTTAACCATCAAAACTAATCCACCAATTGCCAATTGCCAATTAGAAACCCAACCTGCTGACTCATG


Search Again