CR00523

CRIMIC CR00523

Gene Oct-TyrR

CG7485

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80588

Images

Construct Sequences

sgRNA sequence
ACTACCAGTTTGGTGGTCTAGGG

Amplicon 5' Amplicon 3'
GCATGTAAACGCAACCGGAGCCCAAAGAAGGCAAGTGGCAGGGCAGGGAAAGATGCCATCGGCAGATCAGATCCTGTTTGTAAATGTCACCACAACGGTGGCGGCGGCGGCTCTAACCGCTGCGGCCGCCGTCAGCACCACAAAGTCCGGAAGCGGCAACGCCGCACGGGGCTACACGGATTCGGATGACGATGCGGGCATGGGAACGGAGGCGGTGGCTAACATATCCGGCTCGCTGGTGGAGGGCCTGACCACCGTTACCGCGGCATTGAGTACGGCTCAGGCGGACAAGGACTCAGCGGGAGAATGCGAAGGAGCTGTGGAGGAGCTGCATGCCAGCATCCTGGGCCTCCAGCTGGCTGTGCCGGAGTGGGAGGTAATAAGCACAATGATAGTATTTCATTTCATTACTAATAATAACGGATAGCTTCTGCCTTTTTGTTTTTTATTAACGTTTGACAGCAAAAATAAAATATTCACATGCAAACCTTACCTTTTAAAAAATTGCGTTATAAATCCCCTTTTACTTTTGACCATTATTTTGATCAAGTATTTGTATACCCAACCGCCTGTTTGTTCGTACTTCTGTCTGTCCGTCCGTATATCTGTCCGTATGAACAGAAACTATAAAAGAATGTACAACAGGAAGTTGAGATTAAGCATATTGGTTTTAGTTAACTTTTACGCAGTGCAACCAAAATTTAAAAAAATGTTATAATTTTAATAGATTCTATCATTTGTCTTGCCAATTTCTATTGAAAGTTCGCCTGCCACAAATTTCACTTATATTAAGTGTGACCGTCACCACGTAGTGCAAGTGACCCT ACCCTCCCTAGACCACCAAACTGGTAGTTTCTACTCTTTCAATAAGTCTAAATACCAGTAGATCTTATTTATGTTGGTTTAAAGCTCTCCCTAACTTCTTTTCTATTTTAACTAGGCCCTTCTCACCGCCCTGGTTCTCTCGGTCATTATCGTGCTGACCATCATCGGGAACATCCTGGTGATTCTGAGTGTGTTCACCTACAAGCCGCTGCGCATCGTCCAGAACTTCTTCATAGTTTCGCTGGCGGTGGCCGATCTCACGGTGGCCCTTCTGGTGCTGCCCTTCAACGTGGCTTACTCGATCCTGGGGCGCTGGGAGTTCGGCATCCACCTGTGCAAGCTGTGGCTCACCTGCGACGTGCTGTGCTGCACTAGCTCCATCCTGAACCTGTGTGCCATAGCCCTCGACCGGTACTGGGCCATTACGGACCCCATCAACTATGCCCAGAAGAGGACCGTTGGTCGCGTCCTGCTCCTCATCTCCGGGGTGTGGCTACTTTCGCTGCTGATAAGTAGTCCGCCGTTGATCGGCTGGAACGACTGGCCGGACGAGTTCACAAGCGCCACGCCCTGCGAGCTGACCTCGCAGCGAGGCTACGTGATCTACTCCTCGCTGGGCTCCTTCTTTATTCCGCTGGCCATCATGACGATCGTCTACATCGAGATCTTCGTGGCCACGCGGCGCCGCCTAAGGGAGCGAGCCAGGGCCAACAAGCTTAACACGATCGCTCTGAAGTCCACTGAGCTCGAGCCGATGGCAAACTCCTCGCCCGTCGCCGCCTCCAACTCCGGCTCCAAGTCGCGTCTCCTAGCCAGCTGGCTTTGCTGCGGCCGGGATCGGGCCCAGTTCGCCACGCCTATGATCCAGAACGACCAGGAGAGCATCAGCAGTGAAACCCACCAG


Search Again