CR00521

CRIMIC CR00521

Gene Npc1a

CG5722

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78937

Images

Construct Sequences

sgRNA sequence
AGCTAAGCTAAGTTGAAGTCTGG

Amplicon 5' Amplicon 3'
AACTCACCCATGGACGAACCTTGTGTAAACAGAAACGAGCCCATTAAGAATACTAAGACTCCCACCAAGAAGACAGCTGCCATGATGACGAAATAGGCGTCGAGTCCAACAATTTTGAAGGGCTCTGGACGGGGCGGTTCCGGCGGTCCCTGGGGACAGGATAGGTCGCAGTCCGAGCAGGAGCACGCAGGTAGTTTGCTCTACAAGCAATTTATATATTTAGCACAAAATGAAATGAATTTCCAATAAGGATAGTAGGTACATACGCTAACTGCTTGGTTGCAAGGAACGGTCGTTACATTGAGGGGCGTAAAGTTATTGCTATTTGATTTGGGCTCATGTTGAATATAGGTAATTTGAAAAGGAACATATGGATTGGTGGCATCGCCCATAAAGTTGAACCATTTTGTAGGATTGCAGCGAGATGCTGAGTAAGCGCCGCACATTAAATCAAAAGCTAATTGACCCGTTTGCGGTACAGAAACCTATTTGAACACAAACAATAATTATTTTCGATCAATGAATAATGTATATGGAATCCAGAAGTACCTGAGAGCACGATTTATAAGTCTTGTTGATGTATTCCGTTGATATATGCAAGTCAACAGAACTTATGTACTCATCACCTGAAATTCGGAATATATAATTATTCAATAATTAATAAGCTATTAATAATGATTACCTTTCTTATTTTTCTGCGTGGCCACCACATGCATGAACTCAGCCTGCTTTGGTGAACAGGTGAATTGGCAGATGTGCCGCACCAAGTTCTCCATGCAGGATGGACATCGATCCAAGATATTTCCGGCCAGCTCCACATTCTTATTAAGGAGCTCCACCTGCAAAGGCATTTGTTTGATAATTATGACGCCTGGGCAAAGCTAATGCTACTCATAACCTGATTCTTATCGCAGCAAAATTTGTTTTCGCTATTCTCCAGCAGAAATCCACAGCGTTTCTTCAGCAGCTCCAGACCGTCAGTTGCCATTTCCTTCGCTGTTCCATTGTACGGACAGTTTTGGCTGTGCGAAAAGTCATTGGTGTTGCACACGCCATACCAAACGCAGTCCTTAAAAAGTTGCAAAATAAGTTAATAACATTATAGAGCAGAGATATGTAGAGTGAGCTAAGCTAAGTTGAA AGCTATCTTTTTGCTGACCCCAAATACCTTTTTCAAATTTAAATATTACTTCCAAAACTAAGTACGTCATCTCACCGCCACCCAGAGCTATAAAAATATATATTTTTTCTAATTGCCTTGCATCTGTTTTAGCTCATTCATTGTTGAGGTGAAACAACAGCTTTTCCAATACAATTTACCAGTCCATTTTCAGAAATGATTTTACGACGACTAATCTGCGCGATTAAAAACCCAGTATGCTTAATATTGATAAAATATTGAAATTTAATGATAAAAACCAAATGTTAGTTTACCTGTTTCGATGATTGAATTAGCGTAAAGAGCACAGCAGCGATGAGGATGTGTACTCCAAATGGAGATATCCTGAGCGGGGATCTTGGACTCATTCTATCACAATCGCATATCTGTAAAGAACGTTTTTGGTTAAAGTATGCACCTGGGCTTACTATTATGTATGATATTCGAAGTAAGAGTCTCGGTTTTCGACTAAGAACTGAATCAAATGTAATCCGAGCCTGGCAAATTCA


Search Again