CR00519

CRIMIC CR00519

Gene Sln

CG8271

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79274

Images

Construct Sequences

sgRNA sequence
GTCGAGGGTGGTATCTAGTCGGG

Amplicon 5' Amplicon 3'
AAGACGAACCCGCAAAGGATTCAGTGCCAAAGGAGCCGTTCCGGCAGAAGCAGCAGTAGCAAGAGAGTATTTATTTTGGGCCAACCGGTGAAGGCCCGCGAACGTCAGCTCTTCAGGACTTTAAGGACCCAAAGCAGAGGCAACCCAATGCATTTGGGTGCACAACAACAACGCCCCAAGCAACAACAACAACAGCGCGAGCAACAAGAGAAACATCAAAGGCGTTTCACGTTCAGTAAAGGACGGCAATGTCGTCCCTACAGCGTGACTGGCATTTACAGGTGAGTAGTACTACCCAGCATCCCATTATCCTTACTTTGGGAAGGTCAGGAACCATCCCCCTTGATTCCTCCTCGCTGCCTTTTCTGGGGAGTGGGCCAATGGCAATCGTATTGAGGTAGCTGGAGTTTGGGTTCCTCTGGTGAGCATGCGCACTGGACCAGAGAGTGTTTTACGAGTACGTAAACATTGCAAGCGACAGGAGAATGGGTCAACGTCACAAGTTGCATCCATCTTAGTCGCTTTAGAAGAACGGGGACAAGAAAGTAAACAATACATGCCCCGACTGCTGATGGAAAGACCGAAAACCACAAGCCAAAGTTCAGTCGTGGCATGGTGTTGACCTTTAATGACACCTATTAAATCGAATAGAAGTGTTCATTTCTACTAGTTTTGACACAAATGAAAAGTAACTTTTTATTATGCTTATAATTATACTTACACTTACAATCGTTGATTTTGTAAACACTTAAAACATGAATTTTGAGCCAAATTTAAGTAGGTGTTTACACTCGCATATGGGAGTACAGCATCCCTACACTTAAGCATCAATGTCCTGCTGATTGGGTGAACTAATTGGCCTAGGCCTGTGCAACCTAATATCTATTATTACGGAGGGCTAGCAATTACGGGTGGCTCAACAAGTTGTGCGTCAAGTCCTCCCCACTAGATTCCCTCCC TCCCCGACTAGATACCACCCTCGACCAGCCGACTTGAGGCCACCCCTTTCACCTTGACCGCTTATCGTTCAGGCCCACACACGAGCGCCAACTAACTTGGCCCGGGGGAAGGTTCTTCCGTTTCATTAAGCGCTGGCAAAGGCCTTGAAATGTTGGGAAATTGAAAACAACCAGCGATTGCAGAGCTGCCCCAGCGAAAGCTTCCTGACAGCTTAAGCCGGATTCCAGCTGACAGCAGAGGGTGGTCTTGGGGGTTCTTGGCGTCCAGGATATCGTATACCATCGCATGCCACGGCGACGTGGGCCTTTGACATTCGACAAGGTCACTGGCTCTAGGATGCTGTGACTCATGCTCTTGAGGGGGAGTTGCCAAATGCCAAGAGTTGGCCAACGCTCATTAGTCGTGTCAGATGTGTGACTGCATTTTGCACTCGTTCAAGAATATTGCATGCCATCTATTTGGCATATTTCTACCATCAATATGGCTGACAGTTCATAAGCGGCACGA


Search Again