CR00517

CRIMIC CR00517

Gene MFS3

CG4726

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band80587

Images

Construct Sequences

sgRNA sequence
AATGATATTCACATCGGACATGG

Amplicon 5' Amplicon 3'
TCGTTATCGCAAAGCAACGCACTCATAATTGCTGGACATGATTGCCTCCCCCAACCGATTTCAAAAGGGGGTGGACTATATCAATGCGCGTGCGGCGGCTCACTCTACTGACCCTACCCAACTGCCGGTAATCAGTGGCTGCTCCATGTGGAACTCGTTGCTCACCAGGTGATTGGGTTCGGAGCACCCGAGTGGTGTCATGTCCCTATAAATACCTTAATGGTAATGTGTGTAAGGACTATCCCCACTGTCTTTAGATGTTTGCTCTTCCTTCCTTCAATTAAAAAAACAAACGAGAACGTTGTCGTAACGACTATTTGATACCCCTTACTCAGATAGCGATTCAATAACACGGACAAGCAGACGGACAGGGTCAGTTTGTTTCGACTAGTGTTTCCGATCAAGCCCATGTCACACATACACACGTTTCACACGAGTCTAGTATACCCTTCAGCACTTCAAGTAAGGGGTACAATTAATTCCTTAACTTGCTAAATGGAGTCATTTGGCGCAC CGCACCATGTCCGATGTGAATATCATTGGCATTAATCAAATTGACTTGCCAAGCAAACCAACCGAATGACTTATATATCGAGTTGCATTTTCCATCCATCCAAAATGGACGAATCAAGTAAAAATAAAGATTTACAAAGACCTTACCATCTACTTTCCAGAACTCGTGCCCGCCCGCTATGTGCTGGCCCTCCTGGGGTCCATCGGCATGGCCATTGTGTACGGCCTGAAGGTGAATCTCAGCGTGGCCATGGTGGCCATGGTGAACCACACAGCCATTAAGGCCCACGGAGACGGCGGTGGACATGGGGGACACGGCAGCGTCATCCTTTCGAACGCCTCCCAAGTGTCCCTGGTGGAGGAATGCAACCCGCCGGGTGGTGCCTCCAATGTGACGGCTAAGGTGGAGGACGGTCCCTTCGACTGGAGCGAGCCCCTGCAGGGAACCCTGCTGAGCTGCTACTTCTGGGGCTATTTGGTCTCGCAGATTCCGCTGGCACACGTCGCCGAGAACTTCTCCGCCAAGTGGGTGATGCTCTTCTCGGTGGCCATCAACGTCGTGTGCACGCTGCTAACGCCCGTCTTTACTGAATTGCATTACGGTGGCCTGATT


Search Again