CR00516

CRIMIC CR00516

Gene dpr14

CG10946

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no/short band80586

Images

Construct Sequences

sgRNA sequence
AAAAGTGCCAAAGTTTGAGTTGG

Amplicon 5' Amplicon 3'
CTACCTGATTCCTCCGCGACTAGTATCGTAGTTGAGCAGGCGCGGTCCGTGCCGCCAGGTGATATAGGAGGAGGGATGCGGAATCTTCGAAATGACGCACTGCAGCTCGATGGTGCTGCCAGCCTTGTAGTACTTCTCCGGCGTGGCCGAGCCCCGCTCGTCGAGTATCTCCACGTGAGGAACTGCGGATGGACAACGAATGAGATCAGCATGGATCAGCAGGTTTTGCTTGGCAAGCCGACAGCAGTTGCTCACCAATTATAGTAAGGTAAACGAGCAGGACGAGCGGCGGATGCGAGGACACCTGGCACTCGTAGGGACCCTCGTCCCGCTCGTTGGCGAACTGGATGAGCAGCTTCCAATCGTTGGGCTCCTCGAACTCCAGCGAATACCGCGAGTCGCCGCTATATGTGTGCTGGCCAAAGGTTATCAGGGTGAGATCATCGCCACGGCGACGCATCCAGGACACCGTCTTGCCCTGCAGATCGTTCACCCGGCAGTGCAGATAAACGCTGGACGAGAGCTGGGTGCTGATGTTCAGCGTGGTGTACGGATCGGCGAAGAACGGGAACGGCTCGTGGGTGGTCGTCTCGGTGACCTCCAGCTCCTCATCCTCGGGCGTGTCGGTGAACGGCGATGAGAACTCCTGCCAGAAGTTCTTCGGAAACGTGTCGAATGGATCGCCAGCTCGCGGTCGTTTCACTAGTTCGAAAAAAAACAATTTCAATAGATATAGTTAAAATATATATGAAAATCATATAATATATAAAAATAAAATGCACTCAGCTAAAATCACGTATAAAAGAAAAACTCAAATAAAACAATAATTTCGTTTCGAATAATGCTTGCACACTAAGTAGTAAAATAATTGTTTTACATAAAAAAAAATAATCATTTTTCACTTGGGTAATCCGCAAAGTAAACAAAAGAACTTAATCTTCAGCTTAAAAGTGCCAAAGT AAGTTTGCAATGTGATTAAGGCATGAGGTGGAGACTCACATGTGGTCGACGTGGAACCCGAGCCGATGTGATGGAGTGAGGAGTATATAATCGCCAGTATCCAAAACAGCCTCGATCTCATCACTGCAGCGGAGTGTCTTCATATGCCGACTTACGGGATACGGTAACAGGATGCGGGATGATGCATCGACTGGCGCCACTCGCCGCAGGATATGCACATATGAACGAACGCCCCTCTAAACTGTTCTATATCGATCCAAGTCCAACTGCATCAGCGTCCCACTGCATCGCCAGCGATGATTCCACGGACTTCACTTCGCTTCGCTTATCGATTGCCCTGCGGCAAAATATTGCTGGACATATTGCACTCAAGTATCTTCTTTTTCAGAGTGTCCTTTTCGATTATATATGTATATTTACTTTTTCTTTTTCTCTTTTTTGTTGATTTCTTTGCACACTTTTCAGCGCGCGGATGGAGGCTGGAGGGATAGGAATGTCGGACAATTGGAAAATCGGAAAAGCGCTTATTAACCAGCTCGTGTTGCGTGTGTATTTATCCTTTTGCAACTGCTGCTCGGATGGCCAATAAACGGGAATGTAGGTCAGGGCATGCTCTGCGCATGGCCAGCATCCGCATCCCTATTATTTCATCCGAAGGAATCCCTCTACCCGAGCAACAACAACAAATAGCAGACGCCACTCACCTCTCAAGCTCAAAATAATGCAATCTTCAAGATTGTTTTAAAAAGAAAAAGACTTTTCTTTTCTTCTTTTGTTTGCATTTGTCCAGGAAAAAAGCTCTTTTCGGCGGATGGTTCTGATAAATATTTAACAATATAAAAGTTGCTTTTGCCGGTCCTTCGGCGTTGTTGTTCCCTCACCCACACTTGCTTCGGCACTGAATCCGCTCCGAAAGGCCAGCATCTCTCTCGGCATTCTTGCAATCCAGGGATTTCTACCCACCAAACAAGGTCCTTTGAATCCGTATAGCTCGGCATGCAAATAAATCGGGCGATTGAGCTCA


Search Again