CR00512

CRIMIC CR00512

Gene CG42749

CG42749

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78936

Images

Construct Sequences

sgRNA sequence
ATGGTTCAATAAAGCGGAAACGG

Amplicon 5' Amplicon 3'
AAGGGACGTTGCGGTATCTGCGGCGATGCCTACCACGTCAAATCGCCCAGGCCGCACGAGGCTGGTGGTCAATACGCCAAGGGCATCATCTCACGCTACTATACCGCCGGTCAGACGATCGATGTTGAGGTGGAACTGACTGCCAATCATTATGGCCGTTTCGAGATGTTCCTCTGTCCGAACAACAATCCGCGACAGGAGGCGACACAGCAGTGCTTCGATCGTTATCCGTTGCTCATTTCGGGCAGTCGAGAGCATCGGTATCTGATACCGCGTGATGCGAAAAAGAAGGATATATTCCGATACAAGGTACGTTTGCCGCCATATGTCACCTGCACACAGTGCGTACTCCAATGGACCTACTATACGGCCAATATGTGGGGCACCTGTGCCAATGGCACCGAAGCCGTTGGCTGCGGCAAGGCAGGTGAGCAGAGAGTTGAGATAGTTTTCGAATGAAATGATTTATATACATTCAATTAACACAGAGACATTCCGCAATTGTGCGGATGTGGCGATCGTTTCGAATACCGGCGGCGGTATTCCACCGCCTTTCGTGAATAACAAATCGCCATACCTGCTCTATTATCGAGATTATCGTGCTCCGGCGGACAACAACATCTTTCCACTTATTGTGCGGTAAGTAGAGCAAACGCAATGTTTCTTCTCAGTTCTCAGGATTTCGAAACAAAGGATTTAAGCTATCTGTTTTCCACTATCCGCTTCTGCCTTTTTTATTCAGTTTATTGGGTTCTATTATCTTTTTGCTATTCTCTTCTGCTTTAGTTACTTATTAACCGTTTCACTTCACACCTTTCACGA ACCGTTTCCGCTTTATTGAACCATCTCTCCTCGCTGTTCTTCCTCTAACAGAATATGTGTTCTTTGTTCAGCTCTGCGAACACGATTTTAACTCTTGCTTTGGTTTCTAGCAATGCCACGCGGCATGCACGCAAACAAGGCAAGGCTAAGCCGCCTGGCCGTTAAACAGCTTACCCGATACCTGCTTAAAACCGCTTACCCGCTTACCCGCTACCCGATCGCAAACCGATTTGATTACGTTTTTCTAGCCCTAGTCGAAACAGCTATGCACCCGCGTTCGGATGGAATCCCGCCCGAATCGGGTCAGAGTTCAAACGAGTAACGGGTAAAGGTAAATTTCTCCACCGCCTACATTTAAGATTTTAAACGGTTATGGTACACACACGCACAGGCACTGCTGTACATAAAGAAATGCTTGAATAAACTTAAAACCTATAGAAATGCTTTTTATATTGTTTCGCTTAACCGCTTCGCTTAACCGATACAGATTCGAATGGGAATCGAAATGCTTTAGATGCTAACGGTTTGCAATACACATGAAATTTTATTAACTTTGACGTGGCTTCGCTTGGGCCCGAGTAAGAAAACAATAAATTCGAAAAATAATGTGAAATCAAACACCGAATCCGGTTATCGGTGCTTTTCCCGCT


Search Again