CR00511

CRIMIC CR00511

Gene ATPsyndelta

CG2968

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79627

Images

Construct Sequences

sgRNA sequence
TAAATGCCAGTTGGCGTGAATGG

Amplicon 5' Amplicon 3'
AACAGCGGCTGATCACTGAAGTTTTCTCGTGTTTTTCGCTATCAAACCGAAATAAAAACAGGTGAAAATAACTGATAAATTGAGGGGTAGTCCACTGATCACAGTGCCCGAGGATTTGCAATGAAAAGCGATCGAAATTTGAGCTGGGGAAACGCAATAGCAGCCGCCGCCTAACCTACAAAGTTACATAATTTGGTTATTTTGTTGTTATGCTGGCTGGCTGTGGCAGAAAAGACTTTTAATCCTGAATTTATCCTCTCGTTGCAGCCCAAAATGTCCTTCGTTAAGAACGCCCGTTTGCTGGCCGCCCGCGGCGCTCGCTTGGCCCAGAACCGCAGCTACTCGGATGAGATGAAGCTGACCTTCGCCGCCGCCAACAAAACCTTCTACGATGCCGCTGTGGTGCGCCAAATCGATGTGCCTTCCTTCTCGGGATCCTTCGGCATCCTGGCCAAGCACGTGCCCACTCTGGGTAAGTTCGATCATTCAGTTTCAGTTGCCTCGAGATGGTTATATCACCGTTGGCGAATCTCTTTGCTATTGCAGCTGTCCTGAAGCCCGGCGTTGTCCAGGTGGTGGAAAACGATGGCAAGACCCTCAAGTTCTTCGTCTCCAGCGGTTCCGTCACCGTCAACGAGGATTCCTCCGTTCAGGTTCTGGCCGAGGAGGCCCACAACATCGAGGACATCGATGCCAATGAGGCGCGCCAGCTGCTCGCGAAATACCAGTCACAGCTTAGCTCCGCTGGCGACGACAAGGTGCGAATCTAGTCAAGAAGTTGCATAGTAGAGTAGTGTCTAGAAAGTAGAAGTAGTGGTCCAGAAAGTACAACTCAAACAGACTCTTTTGATGGAAACACTGCTTCCACCAT CTTCCACCATTCACGCCAACTGGCATTTAAGTTACTAAACGATTTCTATGTGCCCATCCTTTTTACTTGATATACTTTCTTTGTACAAACAAGTTTGCTCTTAAATTAACGCTTACACATTCGATATTTCCATGAGTAAACTTATGTTTGAGTTGCTTTTGCATTCTGTATTGCACATTCTGAAGCTATCTAAACGAGACTTAACCACGATCCTTGTTTTGCAGGCCAAGGCCCAGGCTGCCATTGCCGTGGAGGTCGCCGAAGCGTTAGTCAAGGCTGCCGAATAGACGTAATCACCACACAACCGCCACCAATAAACCACAATCGATGCTTTGTGTCTGAAATAAATAAAAAACATAACGATCACCTTAAAAAGCCAGAGAGTTATGAAACAATAAAAAAGCGAATCATAATATCGTATTAATGACCCGTGATCCACCAGGCAAATGATTTTTTTTTCTTTTTTTTTTCATGTTATGCCGCTAAACTGTGTGTTTATATAGTTTATAATATATGTATGTGAGCTGGTGAAGAGAAATGTGTAATATTTGCTCGCTGTGGGATAGACCGTTGATATGATAATGCTTTGGCAATCTTTAAGTCAAAAATATGAGTGATTTGCATTTTGGCCGAAAGAGACGAACGTCGTTTCTTTTTCCCTTGCCAATTTATGCAAATCGCATAAGCATAAAAACTTACAATTTGTAAATGAGCTCGTCTTTCATCTTAACAAATAGTATAGTTTGTATTTCATCTGGTGTGTTGCATTCATGGATAGTTCGCATATCTTATCTCGGATGATTGTTTAAATTTCTCTCAAAAGTAGTAATAAAAAGCAACTTTGTTTTTTTTTTATGGAAACAAGAATTAATCAATGGCTAAAATTATACTTTTGGCAGATAGAAGATAATCCATTTTGAAACTCTTTATAAAGATGATAAATACTATAGAATTGAAAAAAGAAAATTGGATTTTTTTTTTTTGGAATTGTCTATGTATTTGGTAACAAAAAAATGTGTTGTAAAAAAAATGTCTTAAATTAACTCATGGCGTTGTGTGGGAATG


Search Again