CR00506

CRIMIC CR00506

Gene betaCOP

CG6223

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78935

Images

Construct Sequences

sgRNA sequence
TAATGGGCATGTCTAGCTAGAGG

Amplicon 5' Amplicon 3'
TGGATTGAAAGCGATGCCCTTTCGCCTAAAGATGCACTACTCACTGGTCTGGTTGACGATCAGCACGTCCAGGACAATATCGTACTGATTGACATTGACGTAGGCCTCCGCATAGACGGGATCCGAGAAGCCAGTCAGTTGGGTGACCTTGTTGAGCTTGCTGTTCGGCGAGGCCACGTCGCTCAGCTGGGCGTTCTTGCTGCCGGCCAACGCCTGGTTCAGACTGGATTCGAACACATTCTCGCCCAGCTGATTGTCACGTCCGTTCGAGAGCTGTGCAAAGAGCACCGGATCGTCCGGCTGCACCTTGGCGGTGGCCTTCTGCTTCTCCTTCAACATGCGCTGGTCCTCGTCGTGCTGCGCATCCAGCATCTTGCCCAGAGCCTCGCGGCAGTACAGTGTGAAGACGGAGATAGCCTCCGGCGTGCGTTCGCTCAGCGTGCGCAGGCAGACGAAGATGCGATCGGTGTCATCGTTGGTTATGGGCTTGCTAGGGAAACCGGACTTGCCCAGGTGCAGTATCGAGCTCATGATCAGCATTACCTGCGTGGTCAGACGATTCTGGGCACGCGCCTCCGTCTCCAGCTCTGCGTAGCGCAGTGCCAGCTTGGTCAACGTGGCGGATAGAGCGGCGCCGATGAAGAAGTCGCCGTCCATCAAGTACTGACGCAATGGCGGACGTTTCTCCGCCTTGGCCACCCTGCAGAAAGCATTAACCAGCGTTAGAATCAGAACTGCAAACAACTATTTTGTAGGTGCTACGTATTAAGATGACTCATTGCCGAACAATAGATAATGGGCA TCAGTGCAAGCTGATGCAATGCCACAAGCCTCGAATGCCTCATTGGTGGCATGATATACGTACACGTAGCCATTACTTACGGGGCCAGACTGTAGGCACTCTGGGTGGCATAGGTTCCATCGGAGGTGACCTTGTTGCTGGCGTTTCCGGAGCCAGAGCCCTCTGCGGCGGATCCAGCTGCATTGCCGCCTGCGGATCCCTGCTGCTGCTTCTGCTCCTCGGTCTGGTCGCCGGCCAAGCGACGCTGCTCCGCCTCCACCATGGGCACTTCGCCCAGCGTCTGCTGAATGACGGCAATCACCTCCAGGATTTGCGAGCCCTCCACGTATTCACCCAAAATCCAAACGGCGGCGCGATGAATTTTGGAGGACTTAATCTGCGGGAAGGCCTCAATTAAATGCTCAATGATGAGGGCGCGCAGGGCGGGGAACTTTTGGATGGCTTCGCGTATGAAGATAAGCACATCGGCGGCGGCAAGTTCGTTGGTATCCGAGAGGAATTCAACCAGTACGGGTATAACATTGGCGGCCACATCGGGAAACTTGATGGAGCAGGTGTGCAGGGTGCGGACGAGCAGCTGCCTGTACTTGCCAGTGTCCTCGTGCTCCACATTGTGCGTCTTGGCCACCTCCTTCTTGAGGACCAGCACCATTTCGCCAATATTACGCGAATAGACCAAGTCCAGGGCCAGCGCGAGTGTTTTCCTGCGCACCTCGATGTCTGGTGCGGCCAGGACGCGCAGAACGTCCATCACCAGATCCTGCATCACCTTCTCCATGCCCTCGTGCTCCTTCATGGCCACCAGGCGATCGAGCACGATTAGCTTGACGTTGTTGTCGCTCTCCTTGACCACCAGTTCGATGTAGCAACTGGCCGCCGCCTTGATGGCCGTGGGCGCCAGCGAGAGCGTAATCAATGTGCCAGCGG


Search Again