CR00505

CRIMIC CR00505

Gene Rbf

CG7413

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78934

Images

Construct Sequences

sgRNA sequence
GGCTTATCTCTATGTCCAAATGG

Amplicon 5' Amplicon 3'
TCCAGACACGTCTCCTCGATGGAGTTAAGGTGCTTTATCAGCGACCGGTTCAAACAGCCTTCGTGCGAGCCGTGCCGCACCACGATCTCGATGATCTTTTGGAACTCGAACGCGCTAATACTGAAACAGTCGAGCACCCACGGGAACTTGAGCTCCGTTTTGTAGGCCTCCAGCACCAGCTCCACGCAGCAGGCCATCAGCGTGATGTTAAAGATGACCAGGGAGACCTTCTGCACCAGCAGTCGCTTGAGATCGATGTCGGGCTTGTTCCGAATTTCCGCCTGCAGGATCTGGTCGAGCAGGTAGAAGAAGAAGGACTTCGCTAGTTGGAAGCGACTCTTCGCCTCCGTTGACGGGTACTTGGCGAGGAATTTCTGCTCGATCTCCTCGATGATGCTAAGCAGCTTGGCTATTACCTCTTCGCCAGCTTGCCTGGATAAAGACAGGGCGATATCAAAACATGAGCTATAGAAATCAATCCCGGATTTAATCTAATCGATTCTTCTTACATCAACAGAAATTTCTATGGATGTGTGCTTCGGCTAACGAAATTCGATATTCGATATTTCCTACGATTTATAAAGCAATCAAATAAACATGAGTTTTGTTTACACGACGCCAACGAC GCCATTTGGACATAGAGATAAGCCTTTTCTCTCTCACAGGTTTTGAATGATAGTTAGGAACACTCGACACCCAACCCAAATACAAGGCCAGCCGGCAACTCACTTGACAAAGTCCGTGGGTTCTGTGATCCGTCCGAAGGCGCTCAGCTGCTTCACGTTGTTAGTGGCGTTGCGGACGGGCTCAAATTTATCGCCAGCCATCGCGGGCTGCGCAGGCAGATCTTGCTTGCGGGTAAGCGGAGTAACCGGCGGACGCAGGGACTGGTCGTTGAGGGCAGTGTGTTCCCCCGCATCGTAGGCACTCAGAATGCGTTCGTCGAATTCGCCGACGCTGAGGACGTACTGCTCGTAGCTGATGTTGAGGGACTTTAGGTTGCGCTCGAAGTTTTCGTTAGCCAATAGGCCTAACATAGTGTCCTTGTTGCCGTAGATGGTCTGGTCGAAATGAAAATAGAACAAATTAATTGTTTTAATGGAAATCCGAAACGGCACTCCTACCGAAGCCTGAAAGAAGCTCGACATGATCTGGCGGAAAGTGGTGGCCTTCATGGCTTTAGCCTCCTCGGTCATGTCACAGAAGTTGGACAAAATGCAGTGCGGATTGTGACGAAAGTCCAGCTCCGTCCAGTTGCTCGGCAGGCCCTCGAATTTGGGGTTGATGAGATCGGTGCGCTTCTCGGCCAGCACATTGTTGTATATCAGGTCTATGCAGCAAATCATCAGATTGTAGGATGTCACCAGGTCCACGGTGTTGCTCGGCTTCTGGTTCTTGGCGCAGAGAAACAGGCGCCAGCAGATGTCGTCCAGCTTGATGTACGAGCACTTTCCGTGGGCGTGGTTGCCATGCAGAGAACTGTTCCAAAGAGGGAAGCTTTTTATATACACGGGGTCAGGCTGA


Search Again